TMEM169 (NM_001142312) Human Untagged Clone

SKU
SC324911
TMEM169 (untagged)-Human transmembrane protein 169 (TMEM169), transcript variant 4
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM169
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001142312, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAGCCAACAGCAGTAGAAGGCCAGGTCCAGCTTCCAAGCCCCCACCAGGGCTCT
CTCAGGAAGGCTGTGGCTGCTGCCCTGGCGCTGGATGGGGAATCCACAATGGGGCACAGG
AAAAAGAAGAGGAAAGAGTCACGCCCAGAATCCATCATCATCTACCGCTCAGACAATGAG
AAAACAGATGAGGAGCCCGGAGAATCAGAAGGTGGAGATCAGCCTAAAGAGGAGGAGGGA
GATGATTTCCTAGACTATCCTGTGGATGATGATATGTGGAACCTGCCTCTGGACAGCCGC
TACGTCACCTTAACTGGGACCATCACACGAGGGAAGAAAAAGGGTCAGATGGTGGACATC
CATGTCACATTGACAGAGAAAGAGCTGCAGGAACTGACCAAACCTAAAGAGTCATCAAGG
GAAACGACGCCTGAAGGAAGAATGGCCTGCCAGATGGGAGCTGACCGTGGGCCCCATGTG
GTCCTCTGGACGCTGATCTGCCTGCCTGTGGTTTTCATCCTTTCTTTTGTTGTCTCTTTC
TACTACGGCACTATCACCTGGTACAACATCTTCCTCGTGTATAATGAGGAAAGGACCTTC
TGGCACAAGATCTCGTATTGCCCTTGCCTCGTTCTCTTCTATCCAGTGCTCATCATGGCC
ATGGCTTCTTCCCTCGGCCTCTACGCTGCTGTGGTCCAGCTCTCGTGGTCCTGGGAAGCA
TGGTGGCAAGCTGCCCGGGACATGGAGAAAGGCTTCTGTGGCTGGCTCTGCAGCAAGCTG
GGTCTGGAGGACTGTTCTCCCTACAGCATTGTGGAGTTGCTTGAATCCGACAATATCTCA
AGCACTCTCTCCAACAAGGACCCCATCCAAGAAGTAGAAACCTCCACGGTC
Restriction Sites Please inquire
ACCN NM_001142312
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001142312.1, NP_001135784.1
RefSeq Size 3385 bp
RefSeq ORF 894 bp
Locus ID 92691
UniProt ID Q96HH4
Cytogenetics 2q35
Protein Families Transmembrane
Write Your Own Review
You're reviewing:TMEM169 (NM_001142312) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227027 TMEM169 (Myc-DDK-tagged)-Human transmembrane protein 169 (TMEM169), transcript variant 4 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC227027L3 Lenti-ORF clone of TMEM169 (Myc-DDK-tagged)-Human transmembrane protein 169 (TMEM169), transcript variant 4 10 ug
$600.00
RC227027L4 Lenti-ORF clone of TMEM169 (mGFP-tagged)-Human transmembrane protein 169 (TMEM169), transcript variant 4 10 ug
$600.00
RG227027 TMEM169 (tGFP-tagged) - Human transmembrane protein 169 (TMEM169), transcript variant 4 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.