SMAD3 (NM_001145104) Human Untagged Clone
CAT#: SC324817
SMAD3 (untagged)-Human SMAD family member 3 (SMAD3), transcript variant 4
"NM_001145104" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SMAD3 |
Synonyms | HSPC193; HsT17436; JV15-2; LDS1C; LDS3; MADH3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145104, the custom clone sequence may differ by one or more nucleotides
ATGAACCACAGCATGGACGCAGGTTCTCCAAACCTATCCCCGAATCCGATGTCCCCAGCA CATAATAACTTGGACCTGCAGCCAGTTACCTACTGCGAGCCGGCCTTCTGGTGCTCCATC TCCTACTACGAGCTGAACCAGCGCGTCGGGGAGACATTCCACGCCTCGCAGCCATCCATG ACTGTGGATGGCTTCACCGACCCCTCCAATTCGGAGCGCTTCTGCCTAGGGCTGCTCTCC AATGTCAACAGGAATGCAGCAGTGGAGCTGACACGGAGACACATCGGAAGAGGCGTGCGG CTCTACTACATCGGAGGGGAGGTCTTCGCAGAGTGCCTCAGTGACAGCGCTATTTTTGTC CAGTCTCCCAACTGTAACCAGCGCTATGGCTGGCACCCGGCCACCGTCTGCAAGATCCCA CCAGGATGCAACCTGAAGATCTTCAACAACCAGGAGTTCGCTGCCCTCCTGGCCCAGTCG GTCAACCAGGGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGC TTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGG ATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGC TCCCCAAGCATCCGCTGTTCCAGTGTGTCT |
Restriction Sites | Please inquire |
ACCN | NM_001145104 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145104.1, NP_001138576.1 |
RefSeq Size | 5441 bp |
RefSeq ORF | 693 bp |
Locus ID | 4088 |
UniProt ID | P84022 |
Cytogenetics | 15q22.33 |
Protein Families | Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors |
Protein Pathways | Adherens junction, Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway, Wnt signaling pathway |
Gene Summary | The SMAD family of proteins are a group of intracellular signal transducer proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. The SMAD3 protein functions in the transforming growth factor-beta signaling pathway, and transmits signals from the cell surface to the nucleus, regulating gene activity and cell proliferation. It also functions as a tumor suppressor. Mutations in this gene are associated with aneurysms-osteoarthritis syndrome and Loeys-Dietz Syndrome 3. [provided by RefSeq, Nov 2019] Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227712 | SMAD3 (Myc-DDK-tagged)-Human SMAD family member 3 (SMAD3), transcript variant 4 |
USD 503.00 |
|
RC227712L3 | Lenti-ORF clone of SMAD3 (Myc-DDK-tagged)-Human SMAD family member 3 (SMAD3), transcript variant 4 |
USD 803.00 |
|
RC227712L4 | Lenti-ORF clone of SMAD3 (mGFP-tagged)-Human SMAD family member 3 (SMAD3), transcript variant 4 |
USD 803.00 |
|
RG227712 | SMAD3 (tGFP-tagged) - Human SMAD family member 3 (SMAD3), transcript variant 4 |
USD 703.00 |
{0} Product Review(s)
Be the first one to submit a review