BORCS5 (NM_058169) Human Untagged Clone

CAT#: SC324648

Reviews ()
Write a review

LOH12CR1 (untagged)-Human loss of heterozygosity, 12, chromosomal region 1 (LOH12CR1)



Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product images

Other products for "BORCS5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BORCS5
Synonyms LOH1CR12; LOH12CR1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_058169.2 CGGAAAGAAGGAGGGCTAGCCGCGTGCGTTCGCGCCGCGCCTCCTTGCGTTTCTGTTCCC
CAAATAGGGCCTCTCCTTCTCCCGCCGCCCAGGCCCCTGCGTGGGCTGGACGCGTCAGCC
CCACACATTAGCCTCGCTGCGGCGCCCAGACTCTGCTTTGCCTCCCCGTCCCGGTCCCTG
GCCCCTGCCCTGTCGCCCGCCGCCGGAGCGGTGACCGCCCGGCCCGCCGTTCTTCTGCTG
CCACCGCTGTCGGCACCATGGGCAGTGAGCAGAGCTCCGAGGCCGAGAGCCGACCCAACG
ATCTGAACTCCTCAGTGACTCCTTCACCAGCCAAGCATAGAGCCAAGATGGATGATATTG
TGGTTGTAGCTCAGGGCTCCCAGGCCTCACGGAACGTCAGCAACGATCCCGATGTCATCA
AGTTGCAAGAGATTCCAACCTTCCAGCCCCTTTTGAAAGGGCTATTGAGTGGCCAGACTT
CCCCAACAAATGCCAAATTGGAGAAACTGGACTCTCAGCAGGTGTTGCAGCTCTGCCTCC
GATATCAAGATCACCTGCATCAGTGTGCAGAGGCCGTTGCTTTTGACCAGAATGCTTTGG
TTAAACGAATCAAAGAGATGGATCTGTCTGTAGAAACTCTGTTCAGCTTCATGCAGGAGC
GCCAGAAAAGATACGCCAAGTATGCCGAGCAGATCCAGAAAGTGAACGAGATGTCCGCCA
TCCTCCGCCGCATACAGATGGGCATCGACCAGACTGTGCCCCTGCTGGACAGGCTCAACA
GCATGCTGCCCGAGGGCGAGCGGCTGGAGCCCTTCAGCATGAAGCCCGACCGCGAGCTCA
GGCTGTAGCTGCCGCCCGGCCTGCCTGGGGCTGGGAGCCCCAGACACCGACACCCTGAGG
ACGTGTGGAGCTAAGGTCATATCATCTGACCAGGTCTGGAGGCTGGCGGGAGGCTCCCTG
AAAGTGGGTGCGAAGGAGTCCGGCTGGCATGAAAATCTGACTTTGCCCAGCTCTTTTCCT
TGATGCAGTTTCCCGGTGTGGAAGGAACCTAACCAGTTCTCGGTGATAACTGAAGCTGGA
ACGTGTGAATTATTAGGAATTCTTTGAAGAACTCTGCATTGAGAATTATTTTTATTTAGT
TTTTTTTTTTTTTAATTGAGAGTATATAGTCCAGTCCAGGTACCGGAATAAAAATATGGA
GACAAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_058169
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_058169.2, NP_477517.1
RefSeq Size 2049 bp
RefSeq ORF 591 bp
Locus ID 118426
UniProt ID Q969J3
Cytogenetics 12p13.2
Gene Summary As part of the BORC complex may play a role in lysosomes movement and localization at the cell periphery. Associated with the cytosolic face of lysosomes, the BORC complex may recruit ARL8B and couple lysosomes to microtubule plus-end-directed kinesin motor. Thereby, it may indirectly play a role in cell spreading and motility.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.