GPR183 (NM_004951) Human Untagged Clone

CAT#: SC324529

GPR183 (untagged)-Human G protein-coupled receptor 183 (GPR183)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GPR183 (NM_004951) Human Untagged Clone
Symbol GPR183
Synonyms EBI2; hEBI2
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004951.3 ACTTCAGTTTGGACAACTACTCACAGCTACTACACAGAGACCCGAACGAGTCACTGATAT
ACACCTGGACCACCACCAATGGATATACAAATGGCAAACAATTTTACTCCGCCCTCTGCA
ACTCCTCAGGGAAATGACTGTGACCTCTATGCACATCACAGCACGGCCAGGATAGTAATG
CCTCTGCATTACAGCCTCGTCTTCATCATTGGGCTCGTGGGAAACTTACTAGCCTTGGTC
GTCATTGTTCAAAACAGGAAAAAAATCAACTCTACCACCCTCTATTCAACAAATTTGGTG
ATTTCTGATATACTTTTTACCACCGCTTTGCCTACACGAATAGCCTACTATGCAATGGGC
TTTGACTGGAGAATCGGAGATGCCTTGTGTAGGATAACTGCGCTAGTGTTTTACATCAAC
ACATATGCAGGTGTGAACTTTATGACCTGCCTGAGTATTGACCGCTTCATTGCTGTGGTG
CACCCTCTACGCTACAACAAGATAAAAAGGATTGAACATGCAAAAGGCGTGTGCATATTT
GTCTGGATTCTAGTATTTGCTCAGACACTCCCACTCCTCATCAACCCTATGTCAAAGCAG
GAGGCTGAAAGGATTACATGCATGGAGTATCCAAACTTTGAAGAAACTAAATCTCTTCCC
TGGATTCTGCTTGGGGCATGTTTCATAGGATATGTACTTCCACTTATAATCATTCTCATC
TGCTATTCTCAGATCTGCTGCAAACTCTTCAGAACTGCCAAACAAAACCCACTCACTGAG
AAATCTGGTGTAAACAAAAAGGCTCTCAACACAATTATTCTTATTATTGTTGTGTTTGTT
CTCTGTTTCACACCTTACCATGTTGCAATTATTCAACATATGATTAAGAAGCTTCGTTTC
TCTAATTTCCTGGAATGTAGCCAAAGACATTCGTTCCAGATTTCTCTGCACTTTACAGTA
TGCCTGATGAACTTCAATTGCTGCATGGACCCTTTTATCTACTTCTTTGCATGTAAAGGG
TATAAGAGAAAGGTTATGAGGATGCTGAAACGGCAAGTCAGTGTATCGATTTCTAGTGCT
GTGAAGTCAGCCCCTGAAGAAAATTCACGTGAAATGACAGAAACGCAGATGATGATACAT
TCCAAGTCTTCAAATGGAAAGTGAAATGGATTGTATTTTGGTTTATAGTGACGTAAACTG
TATGACAAACTTTGCAGGACTTCCCTTATAAAGCAAAATAATTGTTCAGCTTCCAATTAG
TATTCTTTTATATTTCTTTCATTGGGCACTTTCCCATCTCCAACTCGGAAGTAAGCCCAA
GAGAACAACATAAAGCAAACAACATAAAGCACAATAAAAATGCAAATAAATATTTCATTT
TTATTTGTAAACGAATACACCAAAAGGAGGCGCTCTTAATAACTCCCAATGTAAAAAGTT
TTGTTTTAATAAAAAATTTAATTATTATTTCTTGCCAACAAATGGCTAGAAAGGACTGAA
TAGATTATATATTGCCAGATGTTAATACTGTAACATACTTTTTAAATAACATATTTCTTA
AATCCAAATTTCTCTCAATGTTAGATTTAATTCCCTCAATAACACCAATGTTTTGTTTTG
TTTCGTTCTGGGTCATAAAACTTTGTTAAGGAACTCTTTTGGAATAAAGAGCAGGATGCT
ACAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004951.3 unedited
GTACCATTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGGCCATTACGGCCGGGGAC
TTCAGTTTGGACAACTACTCACAGCTACTACACAGAGACCCGAACGAGTCACTGATATAC
ACCTGGACCACCACCAATGGATATACAAATGGCAAACAATTTTACTCCGCCCTCTGCAAC
TCCTCAGGGAAATGACTGTGACCTCTATGCACATCACAGCACGGCCAGGATAGTAATGCC
TCTGCATTACAGCCTCGTCTTCATCATTGGGCTCGTGGGAAACTTACTAGCCTTGGTCGT
CATTGTTCAAAACAGGAAAAAAATCAACTCTACCACCCTCTATTCAACAAATTTGGTGAT
TTCTGATATACTTTTTACCACCGCTTTGCCTACACGAATAGCCTACTATGCAATGGGCTT
TGACTGGAGAATCGGAGATGCCTTGTGTAGGATAACTGCGCTAGTGTTTTACATCAACAC
ATATGCAGGTGTGAACTTTATGACCTGCCTGAGTATTGACCGCTTCATTGCTGTGGTGCA
CCCTCTACGCTACAACAAGATAAAAAGGATTGAACATGCAAAAGGCGTGTGCATATTTGT
CTGGATTCTAGTATTTGCTCAGACACTCCCACTCCTCATCAACCCTATGTCAAAGCAGGA
GGCTGAAAGGATTACATGCATGGAGTATCCAAACTTTGAAGAAACTAAATCTCTTCCCTG
GATTCTGCTTGGGGCATGTTTCATAGGATATGTACTTCCACTTATAATCATTCTCATCTG
CTATTCTCAGATCTGCTGCAAACTCTTCAGACTGCCAACAAAACCCACTCACTGAGAATC
TGTGTAAACAAAAGGCTCTCAACACCATTATTCTATATGTTGTGTTTGTCCTCTGTTCCA
CACCTTACATGTGCATATTCAACATATGATAGAGCTCGTTTCTCTAATTCTTGAATGTAG
CCAAGACATTCGTTTCAGAGATTTTCTGG
Tag Tag Free
ACCN NM_004951
ORF Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004951.3, NP_004942
RefSeq Size 1746
RefSeq ORF 1086
Locus ID 1880
Cytogenetics 13q32.3
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Gene Summary This gene was identified by the up-regulation of its expression upon Epstein-Barr virus infection of primary B lymphocytes. This gene is predicted to encode a G protein-coupled receptor that is most closely related to the thrombin receptor. Expression of this gene was detected in B-lymphocyte cell lines and lymphoid tissues but not in T-lymphocyte cell lines or peripheral blood T lymphocytes. The function of this gene is unknown. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.