SHKBP1 (NM_138392) Human Untagged Clone

CAT#: SC324510

Reviews ()
Write a review

SHKBP1 (untagged)-Human SH3KBP1 binding protein 1 (SHKBP1)



  "NM_138392" in other vectors (7)

USD 760.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name SHKBP1 (NM_138392) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol SHKBP1
Synonyms PP203; Sb1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_138392.1 GGGGGGCTCGCCCGGGGGCCATGGCAGCAGCGGCTACTGCAGCCGAGGGGGTCCCCAGTC
GGGGGCCTCCCGGGGAAGTCATCCATCTGAATGTGGGAGGCAAGAGATTCAGTACCTCTC
GCCAGACTCTCACCTGGATCCCAGACTCCTTCTTCTCCAGTCTTCTGAGCGGACGCATCT
CGACGCTGAAAGATGAGACCGGAGCAATCTTCATCGACAGGGACCCTACAGTCTTCGCCC
CCATCCTCAACTTCCTGCGCACCAAAGAGTTGGATCCCAGGGGTGTCCACGGTTCCAGCC
TCCTCCATGAAGCCCAGTTCTATGGGCTCACTCCTCTGGTTCGTCGCCTGCAGCTTCGAG
AGGAGTTGGATCGATCTTCTTGTGGAAACGTCCTCTTCAATGGTTACCTGCCGCCACCAG
TGTTCCCAGTGAAGCGGCGGAACCGGCACAGCCTAGTGGGGCCTCAGCAGCTAGGAGGAC
GGCCAGCCCCTGTCCGACGGAGCAACACGATGCCCCCCAACCTTGGCAATGCAGGGCTGC
TGGGCCGAATGCTGGATGAGAAAACCCCTCCCTCACCCTCAGGACAACCTGAGGAGCCGG
GGATGGTGCGCCTGGTGTGTGGACACCATAATTGGATCGCTGTGGCCTATACCCAGTTTC
TAGTCTGCTACAGGTTGAAGGAAGCCTCTGGCTGGCAGCTGGTGTTTTCCAGCCCCCGCC
TGGACTGGCCCATCGAACGACTGGCGCTCACAGCCCGGGTGCATGGTGGGGCTTTGGGTG
AACATGACAAGATGGTGGCAGCAGCCACCGGCAGCGAGATCCTGCTATGGGCTCTGCAGG
CGGAAGGCGGTGGCTCCGAGATAGGGGTCTTTCATCTGGGGGTGCCTGTGGAGGCCTTGT
TCTTCGTCGGGAACCAGCTCATTGCTACAAGCCACACAGGGCGCATCGGGGTGTGGAATG
CCGTCACCAAGCACTGGCAGGTCCAGGAGGTGCAGCCCATCACCAGTTATGACGCGGCAG
GCTCCTTCCTCCTCCTGGGCTGCAACAACGGCTCCATTTACTACGTGGATGTGCAGAAGT
TCCCCTTGCGCATGAAAGACAACGACCTCCTTGTCAGCGAGCTCTATCGGGACCCAGCGG
AGGATGGGGTCACCGCCCTCAGTGTCTACCTCACCCCCAAGACCAGTGACAGTGGGAACT
GGATCGAGATCGCCTATGGCACCAGCTCAGGGGGCGTGCGGGTCATCGTGCAGCACCCGG
AGACTGTGGGCTCGGGGCCTCAGCTCTTCCAGACCTTCACTGTGCACCGCAGCCCTGTCA
CCAAGATCATGCTGTCGGAGAAGCACCTCATCTCAGTCTGTGCCGACAACAACCACGTGC
GGACATGGTCTGTGACTCGCTTCCGCGGCATGATTTCCACCCAGCCCGGCTCCACCCCAC
TCGCTTCCTTTAAGATCCTGGCTCTGGAGTCGGCAGATGGGCATGGCGGCTGCAGTGCTG
GCAATGACATTGGCCCCTACGGTGAGCGGGACGACCAGCTAGTGTTCATCCAGAAGGTGG
TGCCCAGTGCCAGCCAGCTCTTCGTGCGTCTCTCATCTACTGGGCAGCGGGTGTGCTCCG
TGCGCTCCGTGGACGGCTCACCCACGACGGCCTTCACAGTGCTGGAGTGCGAGGGCTCCC
GGCGGCTCGGCTCTCGGCCCCGGCGCTACCTGCTCACTGGCCAGGCCAACGGCAGCTTGG
CCATGTGGGACCTAACCACCGCCATGGACGGCCTCGGCCAGGCCCCTGCAGGTGGCCTGA
CGGAGCAAGAGCTGATGGAACAGCTGGAACACTGTGAGCTGGCCCCGCCGGCTCCTTCAG
CTCCCTCATGGGGCTGTCTCCCCAGCCCCTCACCCCGCATCTCCCTCACCAGCCTCCACT
CAGCCTCCAGCAACACCTCCTTGTCTGGCCACCGTGGGAGCCCAAGCCCCCCGCAGGCTG
AGGCCCGGCGCCGTGGTGGGGGCAGCTTTGTGGAACGCTGCCAGGAACTGGTGCGGAGTG
GGCCAGACCTCCGACGGCCACCCACACCAGCCCCGTGGCCCTCCAGCGGTCTCGGCACTC
CCCTCACACCTCCCAAGATGAAGCTCAATGAAACTTCCTTTTGAACAACGCAGCTGCCAT
GATGCCTTGGGATGCCCTGGTCCTGGGGGACTCAGGTGCCTCCCTGATTCCTGTGGGAAC
CCCGGGTTCAGGGCCAGGGCCTCCTTGGAATAAATGGTTATTGTTACTAGGTCCCCACCT
TCCCTCTTTTCTGGAAGCCAAAGTCAGCCTCCCCAATAAAGTCCTCACTGCCTAAAAAAA
AAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_138392
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138392.1, NP_612401.1
RefSeq Size 2362 bp
RefSeq ORF 2124 bp
Locus ID 92799
Cytogenetics 19q13.2
Domains BTB, WD40, K_tetra
Protein Families Ion Channels: Other
Gene Summary Inhibits CBL-SH3KBP1 complex mediated down-regulation of EGFR signaling by sequestration of SH3KBP1. Binds to SH3KBP1 and prevents its interaction with CBL and inhibits translocation of SH3KBP1 to EGFR containing vesicles upon EGF stimulation.[UniProtKB/Swiss-Prot Function]

Other Versions

Other products for "SHKBP1"
Frequently bought together (2)
Rabbit polyclonal antibody to SHKBP1 (SH3KBP1 binding protein 1)
    • 100 ul

USD 430.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools