Adenosine Receptor A2a(ADORA2A) (NM_000675) Human Untagged Clone

CAT#: SC323912

ADORA2A (untagged)-Human adenosine A2a receptor (ADORA2A)

USD 196.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Adenosine Receptor A2a(ADORA2A) (NM_000675) Human Untagged Clone
Symbol ADORA2A
Synonyms A2aR; ADORA2; RDC8
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000675.3 GCAGGAGCCGCCCCCAGCCAAGCTGCTTTCAGCACAGCGTGGGCCCCCAGCACCTTGGTG
CGGGGTGCGGCCCCTCGGAGGAGGGCTGTCAGGTGAAGCCTCGTGTGAGGGGGTGCCTCA
GGAACCCTGAAGCTGGGCTGAGCCATGATGCTGCTGCCAGAACCCCTGCAGAGGGCCTGG
TTTCAGGAGACTCAGAGTCCTCTGTGAAAAAGCCCTTGGAGAGCGCCCCAGCAGGGCTGC
ACTTGGCTCCTGTGAGGAAGGGGCTCAGGGGTCTGGGCCCCTCCGCCTGGGCCGGGCTGG
GAGCCAGGCGGGCGGCTGGGCTGCAGCAATGGACCGTGAGCTGGCCCAGCCCGCGTCCGT
GCTGAGCCTGCCTGTCGTCTGTGGCCATGCCCATCATGGGCTCCTCGGTGTACATCACGG
TGGAGCTGGCCATTGCTGTGCTGGCCATCCTGGGCAATGTGCTGGTGTGCTGGGCCGTGT
GGCTCAACAGCAACCTGCAGAACGTCACCAACTACTTTGTGGTGTCACTGGCGGCGGCCG
ACATCGCAGTGGGTGTGCTCGCCATCCCCTTTGCCATCACCATCAGCACCGGGTTCTGCG
CTGCCTGCCACGGCTGCCTCTTCATTGCCTGCTTCGTCCTGGTCCTCACGCAGAGCTCCA
TCTTCAGTCTCCTGGCCATCGCCATTGACCGCTACATTGCCATCCGCATCCCGCTCCGGT
ACAATGGCTTGGTGACCGGCACGAGGGCTAAGGGCATCATTGCCATCTGCTGGGTGCTGT
CGTTTGCCATCGGCCTGACTCCCATGCTAGGTTGGAACAACTGCGGTCAGCCAAAGGAGG
GCAAGAACCACTCCCAGGGCTGCGGGGAGGGCCAAGTGGCCTGTCTCTTTGAGGATGTGG
TCCCCATGAACTACATGGTGTACTTCAACTTCTTTGCCTGTGTGCTGGTGCCCCTGCTGC
TCATGCTGGGTGTCTATTTGCGGATCTTCCTGGCGGCGCGACGACAGCTGAAGCAGATGG
AGAGCCAGCCTCTGCCGGGGGAGCGGGCACGGTCCACACTGCAGAAGGAGGTCCATGCTG
CCAAGTCACTGGCCATCATTGTGGGGCTCTTTGCCCTCTGCTGGCTGCCCCTACACATCA
TCAACTGCTTCACTTTCTTCTGCCCCGACTGCAGCCACGCCCCTCTCTGGCTCATGTACC
TGGCCATCGTCCTCTCCCACACCAATTCGGTTGTGAATCCCTTCATCTACGCCTACCGTA
TCCGCGAGTTCCGCCAGACCTTCCGCAAGATCATTCGCAGCCACGTCCTGAGGCAGCAAG
AACCTTTCAAGGCAGCTGGCACCAGTGCCCGGGTCTTGGCAGCTCATGGCAGTGACGGAG
AGCAGGTCAGCCTCCGTCTCAACGGCCACCCGCCAGGAGTGTGGGCCAACGGCAGTGCTC
CCCACCCTGAGCGGAGGCCCAATGGCTACGCCCTGGGGCTGGTGAGTGGAGGGAGTGCCC
AAGAGTCCCAGGGGAACACGGGCCTCCCAGACGTGGAGCTCCTTAGCCATGAGCTCAAGG
GAGTGTGCCCAGAGCCCCCTGGCCTAGATGACCCCCTGGCCCAGGATGGAGCAGGAGTGT
CCTGATGATTCATGGAGTTTGCCCCTTCCTAAGGGAAGGAGATCTTTATCTTTCTGGTTG
GCTTGACCAGTCACGTTGGGAGAAGAGAGAGAGTGCCAGGAGACCCTGAGGGCAGCCGGT
TCCTACTTTGGACTGAGAGAAGGGAGCCCCAGGCTGGAGCAGCATGAGGCCCAGCAAGAA
GGGCTTGGGTTCTGAGGAAGCAGATGTTTCATGCTGTGAGGCCTTGCACCAGGTGGGGGC
CACAGCACCAGCAGCATCTTTGCTGGGCAGGGCCCAGCCCTCCACTGCAGAAGCATCTGG
AAGCACCACCTTGTCTCCACAGAGCAGCTTGGGCACAGCAGACTGGCCTGGCCCTGAGAC
TGGGGAGTGGCTCCAACAGCCTCCTGCCACCCACACACCACTCTCCCTAGACTCTCCTAG
GGTTCAGGAGCTGCTGGGCCCAGAGGTGACATTTGACTTTTTTTCCAGGAAAAATGTAAG
TGTGAGGAAACCCTTTTTATTTTATTACCTTTCACTCTCTGGCTGCTGGGTCTGCCGTCG
GTCCTGCTGCTAACCTGGCACCAGAGCCTCTGCCCGGGGAGCCTCAGGCAGTCCTCTCCT
GCTGTCACAGCTGCCATCCACTTCTCAGTCCCAGGGCCATCTCTTGGAGTGACAAAGCTG
GGATCAAGGACAGGGAGTTGTAACAGAGCAGTGCCAGAGCATGGGCCCAGGTCCCAGGGG
AGAGGTTGGGGCTGGCAGGCCCCTGGCATGTGCTGAGTAGCGCAGAGCTACCCAGTGAGA
GGCCTTGTCTAACTGCCTTTCCTTTTAAAGGGAATGTTTTTTTTTGAGATAAAATAAAAA
CGAGCCACATCGTGTTTTAAGCTTGTCCAAATGAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000675.3 unedited
GGCGTTTGTATACGACTCCTATAGGGCGGCCGGCGTATCGCGGCGCGCCGGTACCGGTCC
GGAATTCCCGGGATATCGTCGACCCACGCGTCCGGCAGGAGCCGCCCCCAGCCAAGCTGC
TTTCAGCACAGCGTGGGCCCCCAGCACCTTGGTGCGGGGTGCGGCCCCTCGGAGGAGGGC
TGTCAGGTGAAGCCTCGTGTGAGGGGGTGCCTCAGGAACCCTGAAGCTGGGCTGAGCCAT
GATGCTGCTGCCAGAACCCCTGCAGAGGGCCTGGTTTCAGGAGACTCAGAGTCCTCTGTG
AAAAAGCCCTTGGAGAGCGCCCCAGCAGGGCTGCACTTGGCTCCTGTGAGGAAGGGGCTC
AGGGGTCTGGGCCCCTCCGCCTGGGCCGGGCTGGGAGCCAGGCGGGCGGCTGGGCTGCAG
CAATGGACCGTGAGCTGGCCCAGCCCGCGTCCGTGCTGAGCCTGCCTGTCGTCTGTGGCC
ATGCCCATCATGGGCTCCTCGGTGTACATCACGGTGGAGCTGGCCATTGCTGTGCTGGCC
ATCCTGGGCAATGTGCTGGTGTGCTGGGCCGTGTGGCTCAACAGCAACCTGCAGAACGTC
ACCAACTACTTTGTGGTGTCACTGGCGGCGGCCGACATCGCAGTGGGGTGTGCTCGCCAT
CCCCTTTGCCATCACCATCGCCCCGGGTTCTGCGCTGCTGCCTCGGCTGCCTCTTCATTC
CTGCTCATCCTGGTCATCACGCATAGCCAAACTTCATTCTCATGCTTCGCCATTGACACT
ACATTGCATCCGCATCCCGCCCCGGCACATGGCCTGTGACCCG
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_000675
ORF Size 1239 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000675.3, NP_000666
RefSeq Size 2403
Locus ID 135
Cytogenetics 22q11.23
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction
Gene Summary This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013].
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants, 1, 2, 3, 4, and 5 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.