P5CS (ALDH18A1) (NM_002860) Human Untagged Clone

CAT#: SC323891

Reviews ()
Write a review

ALDH18A1 (untagged)-Human aldehyde dehydrogenase 18 family, member A1 (ALDH18A1), nuclear gene encoding mitochondrial protein, transcript variant 1



  "NM_002860" in other vectors (5)

Reconstitution Protocol

USD 836.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALDH18A1
Synonyms ADCL3; ARCL3A; GSAS; P5CS; PYCS; SPG9; SPG9A; SPG9B
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002860.3 TGCGGACCCGCGGTAGTGCCAGGGGGCGAAGGCGGCGGTGGTGAGGAAGATACTTTGGTT
AGTGACCACATCGCAGCATGTTGAGTCAAGTTTACCGCTGTGGGTTCCAGCCCTTCAACC
AACATCTTCTGCCCTGGGTCAAGTGTACAACCGTCTTCAGATCTCATTGTATCCAGCCTT
CAGTCATCAGACATGTTCGTTCTTGGAGCAACATCCCGTTTATCACTGTACCCCTCAGTC
GTACACATGGCAAGTCCTTCGCCCACCGCAGTGAGCTGAAGCATGCCAAGAGAATCGTGG
TGAAGCTCGGCAGTGCCGTGGTGACCCGAGGGGATGAATGTGGCCTGGCCCTGGGGCGCT
TGGCATCTATTGTTGAGCAGGTATCAGTGCTGCAGAATCAGGGCAGAGAGATGATGCTGG
TGACCAGTGGAGCCGTAGCCTTTGGCAAACAACGCTTGCGCCATGAGATCCTTCTGTCTC
AGAGCGTGCGGCAGGCCCTCCACTCGGGGCAGAACCAGCTGAAAGAAATGGCAATTCCAG
TCTTAGAGGCACGAGCCTGTGCAGCTGCCGGACAGAGTGGGCTGATGGCCTTGTATGAGG
CTATGTTTACCCAGTACAGCATCTGTGCTGCCCAGATTTTGGTGACCAATTTGGATTTCC
ATGATGAGCAGAAGCGCCGGAACCTCAATGGAACACTTCATGAACTCCTTAGAATGAACA
TTGTCCCCATTGTCAACACAAATGATGCTGTTGTCCCCCCAGCTGAGCCCAACAGTGACC
TGCAGGGGGTAAATGTTATTAGTGTTAAAGATAATGATAGCCTGGCTGCCCGACTGGCTG
TGGAAATGAAAACTGATCTCTTGATTGTTCTTTCAGATGTAGAAGGCCTTTTTGACAGCC
CCCCAGGTTCAGATGATGCAAAGCTTATTGATATATTTTATCCCGGAGATCAGCAGTCTG
TGACATTTGGAATCAAGTCTAGAGTGGGAATGGGTGGCATGGAAGCCAAGGTGAAAGCAG
CCCTCTGGGCTTTGCAAGGTGGCACTTCTGTTGTTATTGCCAATGGAACCCACCCAAAGG
TGTCTGGGCACGTCATCACAGACATTGTGGAGGGGAAGAAAGTTGGTACCTTCTTTTCAG
AAGTAAAGCCTGCAGGCCCTACTGTTGAGCAGCAGGGAGAAATGGCGCGATCTGGAGGAA
GGATGTTGGCCACCTTGGAACCTGAGCAGAGAGCAGAAATTATCCATCATCTGGCTGATC
TGTTGACGGACCAGCGTGATGAGATCCTGTTAGCCAACAAAAAAGACTTGGAGGAGGCAG
AGGGGAGACTTGCAGCTCCTCTGCTGAAACGTTTAAGCCTCTCCACATCCAAATTGAACA
GCCTGGCCATCGGTCTGCGACAGATCGCAGCCTCCTCCCAGGACAGCGTGGGACGTGTTT
TGCGCCGCACCCGAATCGCCAAAAACTTGGAACTGGAACAAGTGACTGTCCCAATTGGAG
TTCTGCTGGTGATCTTTGAATCTCGTCCTGACTGTCTACCCCAGGTGGCAGCTTTGGCTA
TCGCAAGTGGCAATGGCTTGTTACTCAAAGGAGGGAAGGAGGCTGCACACAGCAACCGGA
TTCTCCACCTCCTGACCCAGGAGGCTCTCTCAATCCATGGAGTCAAGGAGGCCGTGCAAC
TGGTGAATACCAGAGAAGAAGTTGAAGATCTTTGCCGCCTAGACAAAATGATAGATCTGA
TCATTCCACGTGGCTCTTCCCAGCTGGTCAGAGACATCCAGAAAGCTGCTAAGGGGATTC
CAGTGATGGGGCACAGCGAAGGGATCTGTCACATGTATGTGGATTCCGAGGCCAGTGTTG
ATAAGGTCACCAGGCTAGTCAGAGACTCTAAATGTGAATATCCAGCTGCCTGTAATGCTT
TGGAGACTTTGTTAATCCACCGGGATCTGCTCAGGACACCATTATTTGACCAGATCATTG
ATATGCTGAGAGTGGAACAGGTAAAAATTCATGCAGGCCCCAAATTTGCCTCCTATCTGA
CCTTCAGCCCCTCCGAAGTGAAGTCACTCCGAACTGAGTATGGGGACCTGGAATTATGCA
TTGAAGTAGTGGACAACGTTCAGGATGCCATTGACCACATCCACAAGTATGGCAGCTCCC
ACACGGATGTCATCGTCACAGAGGACGAAAACACAGCGGAGTTCTTCCTGCAGCACGTAG
ACAGTGCCTGTGTGTTCTGGAATGCCAGCACTCGCTTTTCTGATGGTTACCGCTTTGGAC
TGGGAGCTGAAGTGGGAATCAGTACATCGAGAATCCACGCCCGGGGACCAGTAGGACTTG
AGGGACTGCTTACTACTAAGTGGCTGCTGCGAGGGAAGGACCACGTGGTCTCAGATTTCT
CAGAGCATGGAAGTTTAAAATATCTTCATGAGAACCTCCCTATTCCTCAGAGAAACACCA
ACTGAAAAGAGCCAGGAAAACCCGGGAATTTTCCAAAAGGTCTTCACGTTAAACTTGTCT
TATCTCAGGAGAGAGCCCGCTCTTGTCTCCCAGTTCCTGGTAGGGTCTGCCTGTTGGAAA
GTGTACCTGGATGCTTCTGGGCTCCGTTTGGCAATAGCAATCTTGGCTGATGTGCACAGT
CTGGCTCCCAGCTCACCCTTTTTTTTTAAAGTAAGAAAATAGTTGCTACCGATAGGGACT
TTGCCAAGTCCAATTATCTTCTAGGATTGAAAGGTGCATTTTCCCCATAAAAAAGGCGAG
GAAAACCCATGGCTGCTTTGTGTCACCTCAGTGACTTACAGTCCCCCTTGGCATTTAGTT
GGTACTAGAGCCAGTCATCCTTAACAAATCTTTTCACATTTTATTTCTTTCACATGTAGT
CATCTTCAAAAAGGAAAGATTTGGAATTTTAGAAAAGGGGCAACTCTTCTTTTTAGCATT
CTCATCAGAAAGTCACAAAAATCGATGGAATCATTTCCACTGGGAAGATTGACCTTTTGT
ATTTATTTGTGGGGTAAATTAATAAGCATTCCAGATGCTTGCAGCTTCCTGCATCCAGGA
GATGCTGTGTTCCCCGTGATGCAGCTGGAACCCAAGCTGCAGCAGGAGATGCAAGTTTCA
GGATGTTCCCCACTGAGCTGGAGGAATATCTACAGCAGTGATGCTTGAAATTTTTGTATG
AATTATTTTGTCGTCCTACCCTTTTCCTCCAAAACAAAAATTAGAGGATTATTTTAATAC
TTTGGATTCTTCCCCCTTTTTTGAGAAATAAAGTTTTTTATGAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT     
ACCN NM_002860
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002860.3, NP_002851.2
RefSeq Size 3470 bp
RefSeq ORF 2388 bp
Locus ID 5832
UniProt ID P54886
Cytogenetics 10q24.1
Domains aakinase, aldedh
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Metabolic pathways
Gene Summary This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as P5CSL, encodes the longest isoform (1). Variants 1, 4, and 5 all encode the same isoform (1).

Other Versions

Other products for "ALDH18A1"
Frequently bought together (4)
Rabbit Polyclonal Anti-ALDH18A1 Antibody
    • 100 ul

USD 475.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.