SLC25A6 (NM_001636) Human Untagged Clone
CAT#: SC323732
SLC25A6 (untagged)-Human solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein
"NM_001636" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC25A6 |
Synonyms | AAC3; ANT; ANT 2; ANT 3; ANT3; ANT3Y |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001636.1
GGCGGCGGCAGGGCTGAGCCAGCGACGCCCTCCATTCACTCTCCGCGCCCGTTCTCCGGC
TGTCCTCCCGTTCCGCTGCCCGCCCTGCCACCATGACGGAACAGGCCATCTCCTTCGCCA AAGACTTCTTGGCCGGAGGCATCGCCGCCGCCATCTCCAAGACGGCCGTGGCTCCGATCG AGCGGGTCAAGCTGCTGCTGCAGGTCCAGCACGCCAGCAAGCAGATCGCCGCCGACAAGC AGTACAAGGGCATCGTGGACTGCATTGTCCGCATCCCCAAGGAGCAGGGCGTGCTGTCCT TCTGGAGGGGCAACCTTGCCAACGTCATTCGCTACTTCCCCACTCAAGCCCTCAACTTCG CCTTCAAGGATAAGTACAAGCAGATCTTCCTGGGGGGCGTGGACAAGCACACGCAGTTCT GGAGGTACTTTGCGGGCAACCTGGCCTCCGGCGGTGCGGCCGGCGCGACCTCCCTCTGCT TCGTGTACCCGCTGGATTTTGCCAGAACCCGCCTGGCAGCGGACGTGGGAAAGTCAGGCA CAGAGCGCGAGTTCCGAGGCCTGGGAGACTGCCTGGTGAAGATCACCAAGTCCGACGGCA TCCGGGGCCTGTACCAGGGCTTCAGTGTCTCCGTGCAGGGCATCATCATCTACCGGGCGG CCTACTTCGGCGTGTACGATACGGCCAAGGGCATGCTCCCCGACCCCAAGAACACGCACA TCGTGGTGAGCTGGATGATCGCGCAGACCGTGACGGCCGTGGCCGGCGTGGTGTCCTACC CCTTCGACACGGTGCGGCGGCGCATGATGATGCAGTTCGGGCGCAAAGGAGCTGACATCA TGTACACGGGCACCGTCGACTGTTGGAGGAAGATCTTCAGAGATGAGGGGGGCAAGGCCT TCTTCAAGGGTGCGTGGTCCAACGTCCTGCGGGGCATGGGGGGCGCCTTCGTGCTGGTCC TGTACGACGAGCTCAAGAAGGTGATCTAAGGGCCGCGGCCTCCTCCACACACACACACAC CAGGGGAACCAAGAGAACCACGTAGAATCCTCAACCGTGCGGACCATCAACCTTCGAGAA ATTCCAGTTGTCTTTTTCCCAGCCGCATCCTGCCTGTAGATGGCCGGGGAAGGCTCTAGA AAAGGGGCGCATTGCGATCCAACCATCGGCAGCCGATTCCGTGTCTTGATCACGGGGTGG GAGGGAACCGTGGCGTCCCTGCGTGGGGCCCATGGGTGAGACACTCCAGTACTGAGACCT AGAGTCCAGATGCTTGTAGGAGCCAAGTCGTGTTCTAAGTATTTATTTAAAACAAAAGAA TCACGTTTTCCCATTTGTACTTCAGCGCTAGCCCCTGTTTTGCACAGCCGAGTACTGGCG AGTATGTTCTATGTTGGGCCTCCTGCTGCAAAACAATAAACAGAGGACGCAGAGGTCAAA AAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_001636 |
Insert Size | 1500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001636.1, NP_001627.1 |
RefSeq Size | 1455 bp |
RefSeq ORF | 897 bp |
Locus ID | 293 |
UniProt ID | P12236 |
Cytogenetics | X;Y |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Calcium signaling pathway, Huntington's disease, Parkinson's disease |
Gene Summary | This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Jun 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203878 | SLC25A6 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein |
USD 450.00 |
|
RC203878L1 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 750.00 |
|
RC203878L2 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 750.00 |
|
RC203878L3 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 750.00 |
|
RC203878L4 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 750.00 |
|
RG203878 | SLC25A6 (tGFP-tagged) - Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein |
USD 650.00 |
|
SC101210 | SLC25A6 (untagged)-Human solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review