Casein Kinase 1 delta (CSNK1D) (NM_001893) Human Untagged Clone

CAT#: SC323472

CSNK1D (untagged)-Kinase deficient mutant (K38M) of Human casein kinase 1, delta (CSNK1D), transcript variant 1


  "NM_001893" in other vectors (7)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-CSNK1D Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Casein Kinase 1 delta"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Casein Kinase 1 delta
Synonyms ASPS; CKI-delta; CKId; CKIdelta; FASPS2; HCKID
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001893, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGAGAGTCGGGAACAGGTACCGGCTGGGCCGGAAGATCGGCAGCGGCTCCTTCGGAGACATCT
ATCTCGGTACGGACATTGCTGCAGGAGAAGAGGTTGCCATCAAGCTTGAATGTGTCAAAACCAAACACCC
TCAGCTCCACATTGAGAGCAAAATCTACAAGATGATGCAGGGAGGAGTGGGCATCCCCACCATCAGATGG
TGCGGGGCAGAGGGGGACTACAACGTCATGGTGATGGAGCTGCTGGGGCCAAGCCTGGAGGACCTCTTCA
ACTTCTGCTCCAGGAAATTCAGCCTCAAAACCGTCCTGCTGCTTGCTGACCAAATGATCAGTCGCATCGA
ATACATTCATTCAAAGAACTTCATCCACCGGGATGTGAAGCCAGACAACTTCCTCATGGGCCTGGGGAAG
AAGGGCAACCTGGTGTACATCATCGACTTCGGGCTGGCCAAGAAGTACCGGGATGCACGCACCCACCAGC
ACATCCCCTATCGTGAGAACAAGAACCTCACGGGGACGGCGCGGTACGCCTCCATCAACACGCACCTTGG
AATTGAACAATCCCGAAGAGATGACTTGGAGTCTCTGGGCTACGTGCTAATGTACTTCAACCTGGGCTCT
CTCCCCTGGCAGGGGCTGAAGGCTGCCACCAAGAGACAGAAATACGAAAGGATTAGCGAGAAGAAAATGT
CCACCCCCATCGAAGTGTTGTGTAAAGGCTACCCTTCCGAATTTGCCACATACCTGAATTTCTGCCGTTC
CTTGCGTTTTGACGACAAGCCTGACTACTCGTACCTGCGGCAGCTTTTCCGGAATCTGTTCCATCGCCAG
GGCTTCTCCTATGACTACGTGTTCGACTGGAACATGCTCAAATTTGGTGCCAGCCGGGCCGCCGATGACG
CCGAGCGGGAGCGCAGGGACCGAGAGGAGCGGCTGAGACACTCGCGGAACCCGGCTACCCGCGGCCTCCC
TTCCACAGCCTCCGGCCGCCTGCGGGGGACGCAGGAAGTGGCTCCCCCCACACCCCTCACCCCTACCTCA
CACACGGCTAACACCTCCCCCCGGCCCGTCTCCGGCATGGAGAGAGAGCGGAAAGTGAGTATGCGGCTGC
ACCGCGGGGCCCCCGTCAACATCTCCTCGTCCGACCTCACAGGCCGACAAGATACCTCTCGCATGTCCAC
CTCACAGATTCCTGGTCGGGTGGCTTCCAGTGGTCTTCAGTCTGTCGTGCACCGATGA


>OriGene 5' read for mutant NM_001893 unedited
ACCGCCGTTCAGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAA
CCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCGCGATGGCGGCG
GCTCCTTTAGGCAGCTGAAAGGGGATTTAGGCCCGGAAGATCCGAGTCCATCCGCGGCGGGGAGAGGGCA
AGCGGGACCGGTAGGGGCCGGAGCAGCGGCGGCGGCGCTCGGACTGTCCCATCCGCCCCGTATTGAGGCG
CTGGGAGCGGCGGGGCGACAGGAAAGCGATGGTGAAAGCGGGGGCCGTGAGGGGGGGCGGGAGCCGGGAG
CCGGACCCGCAGTAGCGGCAGCAGCGGCGCCCGCCCTCCCCAGAGGTTCCAGACCCAGGGAAGCGCGGCC
AATTGAACCTTGACCGGGGGGAGAGATTAGGGGGCTGGGACGGGAGGCGGAAGGAGGGGGGGGGGGGAGA
AAACG
>SC323472 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
GCAKGCGGAGWCGGCAGCGGCTCTTCGGAGACATCTATCTCGGTACGGACATTGCTGCAGGAGAAGAGGT
TGCCATCATGCTTGAATGTGTCAAAACCAAACACCCTCAGCTCCACATTGAGAGCCTGCAGGAGAAGAGG
TTGCCATCATGCTTGAATGTGTCAAAACCAAACACCCTCAGCTCCACATTGAGAGCCTGCAGGAGAAGAG
GTTGCCATCATGCTTGAATGTGTCAAAACCAAACACCCTCAGCTC
Restriction Sites Please inquire     
ACCN NM_001893
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001893.3, NP_001884.2
RefSeq Size 2030 bp
RefSeq ORF 1248 bp
Locus ID 1453
UniProt ID P48730
Cytogenetics 17q25.3
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Circadian rhythm - mammal, Gap junction, Hedgehog signaling pathway
Gene Summary This gene is a member of the casein kinase I (CKI) gene family whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. The encoded protein is highly similar to the mouse and rat CK1 delta homologs. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.