PKC delta (PRKCD) (NM_006254) Human Untagged Clone

CAT#: SC323442

Reviews ()
Write a review

PRKCD (untagged)-Kinase deficient mutant (K378M) of Human protein kinase C, delta (PRKCD), transcript variant 1



Reconstitution Protocol

USD 930.00

In Stock*

Size
    • 10 ug

Product images

Other products for "PRKCD"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRKCD
Synonyms ALPS3; CVID9; MAY1; nPKC-delta; PKCD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC323442 sequence for NM_006254 edited (data generated by NextGen Sequencing)
ATGGCGCCGTTCCTGCGCATCGCCTTCAACTCCTATGAGCTGGGCTCCCTGCAGGCCGAG
GACGAGGCGAACCAGCCCTTCTGTGCCGTGAAGATGAAGGAGGCGCTCAGCACAGAGCGT
GGGAAAACACTGGTGCAGAAGAAGCCGACCATGTATCCTGAGTGGAAGTCGACGTTCGAT
GCCCACATCTATGAGGGGCGCGTCATCCAGATTGTGCTAATGCGGGCAGCAGAGGAGCCA
GTGTCTGAGGTGACCGTGGGTGTGTCGGTGCTGGCCGAGCGCTGCAAGAAGAACAATGGC
AAGGCTGAGTTCTGGCTGGACCTGCAGCCTCAGGCCAAGGTGTTGATGTCTGTTCAGTAT
TTCCTGGAGGACGTGGATTGCAAACAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCA
ACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAG
TTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGG
GGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGC
ATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTC
CAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGC
CCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAG
TGTGAAGACTGCGGCATGAATGTGCACCATAAATGCCGGGAGAAGGTGGCCAACCTCTGC
GGCATCAACCAGAAGCTTTTGGCTGAGGCCTTGAACCAAGTCACCCAGAGAGCCTCCCGG
AGATCAGACTCAGCCTCCTCAGAGCCTGTTGGGATATATCAGGGTTTCGAGAAGAAGACC
GGAGTTGCTGGGGAGGACATGCAAGACAACAGTGGGACCTACGGCAAGATCTGGGAGGGC
AGCAGCAAGTGCAACATCAACAACTTCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTC
GGGAAGGTGCTGCTTGGAGAGCTGAAGGGCAGAGGAGAGTACTTTGCCATCATGGCCCTC
AAGAAGGATGTGGTCCTGATCGACGACGACGTGGAGTGCACCATGGTTGAGAAGCGGGTG
CTGACACTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAG
GACCACCTGTTCTTTGTGATGGAGTTCCTCAACGGGGGGGACCTGATGTACCACATCCAG
GACAAAGGCCGCTTTGAACTCTACCGTGCCACGTTTTATGCCGCTGAGATAATGTGTGGA
CTGCAGTTTCTACACAGCAAGGGCATCATTTACAGGGACCTCAAACTGGACAATGTGCTG
TTGGACCGGGATGGCCACATCAAGATTGCCGACTTTGGGATGTGCAAAGAGAACATATTC
GGGGAGAGCCGGGCCAGCACCTTCTGCGGCACCCCTGACTATATCGCCCCTGAGATCCTA
CAGGGCCTGAAGTACACATTCTCTGTGGACTGGTGGTCTTTCGGGGTCCTTCTGTACGAG
ATGCTCATTGGCCAGTCCCCCTTCCATGGTGATGATGAGGATGAACTCTTCGAGTCCATC
CGTGTGGACACGCCACATTATCCCCGCTGGATCACCAAGGAGTCCAAGGACATCCTGGAG
AAGCTCTTTGAAAGGGAACCAACCAAGAGGCTGGGAGTGACGGGAAACATCAAAATCCAC
CCCTTCTTCAAGACCATAAACTGGACTCTGCTGGAAAAGCGGAGGTTGGAGCCACCCTTC
AGGCCCAAAGTGAAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCCTGAACGAG
AAGGCGCGCCTCTCCTACAGCGACAAGAACCTCATCGACTCCATGGACCAGTCTGCATTC
GCTGGCTTCTCCTTTGTGAACCCCAAATTCGAGCACCTCCTGGAAGATTGA

Clone variation with respect to NM_006254.3
1133 a=>t;1441 c=>t;1782 c=>g;1857 t=>c
>OriGene 5' read for mutant NM_006254 unedited
CCGCCCGTTGTAGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGA
ACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGCGGCGCCGGA
GCCCGAGGCGGCTGTAGCCCACATCTCCCGAGCGACCCCCGGCGCCCGCCCGCCGCGCGGAGGCCCGGGC
CACACCTCACTGGCCGCTTGGCCCATCCCAGTCAGCGCCGCGCCGAACCCCGTCCGCGCGCGCCGGGGAG
CGGCGCCCCCGCCGCTGCCGCCGCGACCCTTGGCGCCTGCCCCTGCAACGGGAGCCCCACTGCAGGCCCC
ACCATGGCGCCGTTCCTGCGCATCGCCTTTCAACTCTATGAAGCTGGGGCTCCCTGCAGGCCGAGGACGA
AGGCGAACCACCCTTCTTGTGCCTTGAGATGAAGGAGGCGCTCAGCCAGACCGTGGGAAAACCCTGGTTG
CAGAAGAGCCACCTTGTATCCTGATTGGAAGTCGACGTTGAATGCCAACTTCTTTGAGGGGCGGTTTCCG
ATGGGCTATGCGGCAGCAAGAGACCCATTTCTGAGGGACCTGGTGTGCGTGTCGGCCAACCGTGCAGATA
CATGGCAGAGCTATTCGTGTGGACTGCACTTGGCAAGGTGAATCTGCCAGATTCTGGACTGATATGCACC
TTACCATGGCCAGGCATTTCTGAGGACACCGTCGGACTTCAAGCGTAATGCAAATAACA
>SC323442 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
GRCAGTGCACATCAACACTTCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTCGGGAAGGTGCTGCTTG
GAGAGCTGAAGGGCAGAGGAGAGTACTTTGCCATCATGGCCCTCAAGAAGGATGTGGTCCTGATCGACGA
CGACGTGGAGTGCACCATGGTTGAGAAGCGGGTGCTGACACTTGCCGCAGAGAATCCCTTTCTCACCCAC
CTCATCTGCACCTTCCAGACCAAGGACCACCTGTTCTTTGTGATG
Restriction Sites Please inquire     
ACCN NM_006254
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006254.3, NP_006245.2
RefSeq Size 2850 bp
RefSeq ORF 2031 bp
Locus ID 5580
UniProt ID Q05655
Cytogenetics 3p21.1
Domains pkinase, S_TK_X, TyrKc, DAG_PE-bind, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Chemokine signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, GnRH signaling pathway, Neurotrophin signaling pathway, Tight junction, Type II diabetes mellitus, Vascular smooth muscle contraction
Gene Summary The protein encoded by this gene is a member of the protein kinase C family of serine- and threonine-specific protein kinases. The encoded protein is activated by diacylglycerol and is both a tumor suppressor and a positive regulator of cell cycle progression. Also, this protein can positively or negatively regulate apoptosis. Defects in this gene are a cause of autoimmune lymphoproliferative syndrome. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence compared to variant 4. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 1, 2, 3, 6, and 7 all encode the same isoform (c).
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.