KCTD15 (NM_001129995) Human Untagged Clone

CAT#: SC322949

KCTD15 (untagged)-Human potassium channel tetramerisation domain containing 15 (KCTD15), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCTD15
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001129995, the custom clone sequence may differ by one or more nucleotides
  ATGCCTCACCGCAAGGAGCGGCCGAGCGGGTCCTCGCTTCACACACACGGCAGCACCGGC
  ACCGCGGAGGGAGGAAACATGTCCCGGCTGTCTCTCACCCGGTCGCCTGTGTCTCCCCTG
  GCTGCCCAGGGCATCCCCCTGCCAGCCCAGCTCACCAAGTCCAATGCACCTGTGCACATC
  GATGTGGGCGGCCACATGTACACCAGCAGCCTGGCCACGCTCACCAAGTACCCTGACTCC
  AGGATAAGCCGCCTCTTCAATGGCACTGAACCCATCGTCCTGGACAGTTTGAAGCAACAT
  TATTTCATTGACCGGGATGGGGAGATTTTCCGCTACGTCCTGAGCTTCCTGCGGACGTCC
  AAGCTGCTGCTTCCGGATGACTTTAAGGACTTCAGTCTGCTGTACGAGGAGGCGCGCTAC
  TATCAGCTCCAGCCCATGGTGCGCGAGCTGGAGCGCTGGCAGCAGGAGCAGGAGCAGCGG
  CGCCGCAGCCGGGCCTGTGACTGCCTGGTGGTGCGCGTCACGCCCGACTTGGGCGAGCGG
  ATCGCACTCAGCGGCGAGAAGGCCCTCATCGAGGAGGTCTTCCCCGAGACCGGAGACGTC
  ATGTGCAACTCCGTCAACGCCGGCTGGAACCAGGACCCCACGCACGTCATCCGCTTCCCG
  CTCAATGGCTACTGCCGGCTCAACTCGGTACAGGTCCTGGAGCGGCTGTTCCAGAGGGGT
  TTCAGCGTGGCTGCGTCCTGTGGGGGCGGTGTGGACTCCTCCCAGTTCAGCGAGTATGTG
  CTTTGCCGGGAGGAGCGGCGGCCGCAGCCCACCCCCACTGCTGTTCGAATCAAGCAGGAA
  CCCCTGGAC
  
• Restriction Sites: Please inquire
• ACCN: NM_001129995
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001129995.1, NP_001123467.1
• RefSeq Size: 3933 bp
• RefSeq ORF: 852 bp
• Locus ID: 79047
• UniProt ID: Q96SI1
• Cytogenetics: 19q13.11
• Protein Families: Ion Channels: Other
• Gene Summary: During embryonic development, interferes with neural crest formation (By similarity). Inhibits AP2 transcriptional activity by interaction with its activation domain.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses a different splice site in the 5' UTR and in the 3' coding region, compared to variant 1, that results in a frameshift. The resulting protein (isoform 2) has a longer and distinct C-terminus compared to isoform 1. Variants 2 and 3 both encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.