GBA3 (NM_001128432) Human Untagged Clone
CAT#: SC322858
GBA3 (untagged)-Human glucosidase, beta, acid 3 (cytosolic) (GBA3), transcript variant 2
"NM_001128432" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GBA3 |
Synonyms | CBG; CBGL1; GLUC; KLRP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001128432, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTCCCTGCAGGATTTGGATGGGCGGCAGCCACTGCAGCTTATCAAGTAGAAGGA GGCTGGGATGCAGATGGAAAAGGCCCTTGTGTCTGGGACACATTTACTCATCAGGGAGGA GAGAGAGTTTTCAAGAACCAGACTGGCGATGTAGCTTGTGGCAGCTACACTCTGTGGGAG GAAGATTTGAAATGTATCAAACAGCTTGGATTGACTCATTACCGCTTCTCTCTTTCCTGG TCACGTCTGTTACCTGATGGGACGACAGGTTTCATCAACCAGAAAGCTATCCAACTTGAT AAAGTCAATCTTCAAGTATATTGTGCATGGTCTCTTCTGGATAACTTTGAGTGGAACCAG GGATACAGCAGCCGGTTTGGTCTCTTCCACGTTGATTTTGAAGACCCAGCTAGACCCCGA GTCCCTTACACATCGGCCAAGGAATATGCCAAGATCATCCGAAACAATGGCCTTGAAGCA CATCTG |
Restriction Sites | Please inquire |
ACCN | NM_001128432 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001128432.1, NP_001121904.1 |
RefSeq Size | 1226 bp |
RefSeq ORF | 489 bp |
Locus ID | 57733 |
UniProt ID | Q9H227 |
Cytogenetics | 4p15.2 |
Protein Pathways | Cyanoamino acid metabolism, Starch and sucrose metabolism |
Gene Summary | The protein encoded by this gene is an enzyme that can hydrolyze several types of glycosides. This gene is a polymorphic pseudogene, with the most common allele being the functional allele that encodes the full-length protein. Some individuals, as represented by the reference genome allele, contain a single nucleotide polymorphism that results in a premature stop codon in the coding region, and therefore this allele is pseudogenic due to the failure to produce a functional full-length protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (2, coding) lacks two alternate exons resulting in the loss of an in-frame segment in the central coding region, compared to variant 1. The encoded isoform (b) has the same N- and C-termini but is shorter compared to isoform a. This variant is produced from the more frequently occurring functional allele of this gene. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225153 | GBA3 (Myc-DDK-tagged)-Human glucosidase, beta, acid 3 (cytosolic) (GBA3), transcript variant 2 |
USD 165.00 |
|
RC225153L3 | Lenti-ORF clone of GBA3 (Myc-DDK-tagged)-Human glucosidase, beta, acid 3 (cytosolic) (GBA3), transcript variant 2 |
USD 465.00 |
|
RC225153L4 | Lenti-ORF clone of GBA3 (mGFP-tagged)-Human glucosidase, beta, acid 3 (cytosolic) (GBA3), transcript variant 2 |
USD 465.00 |
|
RG225153 | GBA3 (tGFP-tagged) - Human glucosidase, beta, acid 3 (cytosolic) (GBA3), transcript variant 2 |
USD 365.00 |
{0} Product Review(s)
Be the first one to submit a review