RALY (NM_016732) Human Untagged Clone

CAT#: SC322780

RALY (untagged)-Human RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse)) (RALY), transcript variant 1

  View "NM_016732" in other vectors (11)

USD 640.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name RALY (NM_016732) Human Untagged Clone
Symbol RALY
Synonyms HNRPCL2; P542
Vector pCMV6-AC
Sequence Data
>OriGene sequence for SC322780 GCCGCTGTCAGTGCGGCGGGGCGCGCGAGCGGCGCCAGCTCGGGGCAGCGGAACCCAGAG
AAGCTGAGGGGGCGGTAGCGGCGGCGACGGCGACGACGACGACTCCCGCGCGTGTGCCCA
GCCTCTTCCCGCCGCAGCCGCCCTTTTCCTCCCTCCCTTACGTCCCCGAGTGCGGCAGTA
CCGCCTCCTTCCCAGCCGCGCGGCTTCCTCCAGACCTCTCGGCGCGGGTGAGCCCTATTC
CCAGAGGCAGGTGGTGCTGACCCTGTAACCCAAAGGAGGAAACAGCTGGCTAAGCTCATC
ATTGTTACTGGTGGTCACCATGTCCTTGAAGCTTCAGGCAAGCAATGTAACCAACAAGAA
TGACCCCAAGTCCATCAACTCTCGAGTCTTCATTGGAAACCTCAACACAGCTCTGGTGAA
GAAATCAGATGTGGAGACCATCTTCTCTAAGTATGGCCGTGTGGCCGGCTGTTCTGTGCA
CAAGGGCTATGCCTTTGTTCAGTACTCCAATGAGCGCCATGCCCGGGCAGCTGTGCTGGG
AGAGAATGGGCGGGTGCTGGCCGGGCAGACCCTGGACATCAACATGGCTGGAGAGCCTAA
GCCTGACAGACCCAAGGGGCTAAAGAGAGCAGCATCTGCCATATACAGTGGCTACATCTT
TGACTATGATTACTACCGGGACGACTTCTACGACAGGCTCTTCGACTACCGGGGCCGTCT
GTCGCCCGTGCCAGTGCCCAGGGCGGTCCCTGTGAAGCGACCCCGGGTCACAGTCCCTTT
GGTCCGGCGTGTCAAAACTAACGTACCTGTCAAGCTCTTTGCCCGCTCCACAGCTGTCAC
CACCAGCTCAGCCAAGATCAAGTTAAAGAGCAGTGAGCTGCAGGCCATCAAGACGGAGCT
GACACAGATCAAGTCCAATATCGATGCCCTGCTGAGCCGCTTGGAGCAGATCGCTGCGGA
GCAAAAGGCCAATCCAGATGGCAAGAAGAAGGGTGATGGAGGTGGCGCCAGCGGCGGCGG
CGGCGGTGGTGGTGGCAGCGGTGGCGGTGGCAGTGGTGGTGGCGGTGGCGGTGGCAGCAG
CCGGCCACCAGCCCCCCAAGAGAACACAACTTCTGAGGCAGGCCTGCCCCAGGGGGAAGC
ACGGACCCGAGACGACGGCGATGAGGAAGGGCTCCTGACACACAGCGAGGAAGAGCTGGA
ACACAGCCAGGACACAGACGCGGATGATGGGGCCTTGCAGTAAGCAGCCTGACAGGAGCA
ATGGCCACCAGCAGGTGAAGGGCATCGCTGCCCCAGGCCTCAAGCCGGGCACCCAACCCT
GGATGCCACCCCCCAGCGGGTACCAGAGGAAAGCTGGCAGCAGGCGCCTCCTCCCCCAAC
GCATCCCAGCCAGTGCCATGTCCTCTGCAGGTGGAGTTACTGGCCTACTCCTTCCCCATG
AGCCCTCCCTGTCTGCACTGCCCAGGCCAGAGGGTAGAGCACAGGGGTTTCCCCATACTA
CCTCCCCTCCCCAGGACACTCCCAGGCTTGGGTTTTTTCTATAGGTTTGGCGGGGGGCCA
CAGGGAGGGGACCCTGACAATAAAGAGATTGGATCCCAAAAAAAAAAAAAAAAA
>OriGene 5' read for SC322780 unedited
GTGAATTTTAGTGCATTGTATACGACTCCTATAGGGCGGCAGGCTGATCGCGGCGCGCCG
GTACCGGTCCGGAATTCCCGGGATGCCGCTGTCAGTGCGGCGGGGCGCGCGAGCGGCGCC
AGCTCGGGGCAGCGGAACCCAGAGAAGCTGAGGGGGCGGTAGCGGCGGCGACGGCGACGA
CGACGACTCCCGCGCGTGTGCCCAGCCTCTTCCCGCCGCAGCCGCCCTTTTCCTCCCTCC
CTTACGTCCCCGAGTGCGGCAGTACCGCCTCCTTCCCAGCCGCGCGGCTTCCTCCAGACC
TCTCGGCGCGGGTGAGCCCTATTCCCAGAGGCAGGTGGTGCTGACCCTGTAACCCAAAGG
AGGAAACAGCTGGCTAAGCTCATCATTGTTACTGGTGGTCACCATGTCCTTGAAGCTTCA
GGCAAGCAATGTAACCAACAAGAATGACCCCAAGTCCATCAACTCTCGAGTCTTCATTGG
AAACCTCAACACAGCTCTGGTGAAGAAATCAGATGTGGAGACCATCTTCTCTAAGTATGG
CCGTGTGGCCGGCTGTTCTGTGCACAAGGGCTATGCCTTTGTTCAGTACTCCAATGAGCG
CCATGCCCGGGCAGCTGTGCTGGGAGAGAATGGGCGGGTGCTGGCCGGGCAGACCCTGGA
CATCAACATGGCTGGAGAGCCTAAGCCTGACAGACCCAAGGGGCTAAAGAGAGCAGCATC
TGCCATATACAGTGGCTACATCTTTGACTATGATTACTACCGGGACGACTCTACGACAGG
CTCTTCGACTACCGGGGCGTCTGTCGCCCGTGCAGTGCCAGGCGTCCCTGTGAGCGACCC
GGGTCACAGTCATTGTCCGGCGTGTCAACTACGTACTGTCAGCTTTTGCCGCTCCAAGC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_016732
ORF Size 921 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_016732.1, NP_057951
RefSeq Size 1589
RefSeq ORF 921
Locus ID 22913
Cytogenetics 20q11.22
Domains rrm
Gene Summary This gene encodes a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) gene family. This protein may play a role in pre-mRNA splicing and in embryonic development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). This isoform is also known as long isoform.

Other Versions

Other products for "RALY"
Frequently bought together (2)
Rabbit polyclonal anti-RALY antibody
    • 100 ul

USD 335.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies