FPRL1(FPR2) (NM_001462) Human Untagged Clone

CAT#: SC322591

FPR2 (untagged)-Human formyl peptide receptor 2 (FPR2), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FPRL1(FPR2) (NM_001462) Human Untagged Clone
Symbol FPR2
Synonyms ALXR; FMLP-R-II; FMLPX; FPR2A; FPRH1; FPRH2; FPRL1; HM63; LXA4R
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322591 GTGCTGCTGGCAAGATGGAAACCAACTTCTCCACTCCTCTGAATGAATATGAAGAAGTGT
CCTATGAGTCTGCTGGCTACACTGTTCTGCGGATCCTCCCATTGGTGGTGCTTGGGGTCA
CCTTTGTCCTCGGGGTCCTGGGCAATGGGCTTGTGATCTGGGTGGCTGGATTCCGGATGA
CACGCACAGTCACCACCATCTGTTACCTGAACCTGGCCCTGGCTGACTTTTCTTTCACGG
CCACATTACCATTCCTCATTGTCTCCATGGCCATGGGAGAAAAATGGCCTTTTGGCTGGT
TCCTGTGTAAGTTAATTCACATCGTGGTGGACATCAACCTCTTTGGAAGTGTCTTCTTGA
TTGGTTTCATTGCACTGGACCGCTGCATTTGTGTCCTGCATCCAGTCTGGGCCCAGAACC
ACCGCACTGTGAGTCTGGCCATGAAGGTGATCGTCGGACCTTGGATTCTTGCTCTAGTCC
TTACCTTGCCAGTTTTCCTCTTTTTGACTACAGTAACTATTCCAAATGGGGACACATACT
GTACTTTCAACTTTGCATCCTGGGGTGGCACCCCTGAGGAGAGGCTGAAGGTGGCCATTA
CCATGCTGACAGCCAGAGGGATTATCCGGTTTGTCATTGGCTTTAGCTTGCCGATGTCCA
TTGTTGCCATCTGCTATGGGCTCATTGCAGCCAAGATCCACAAAAAGGGCATGATTAAAT
CCAGCCGTCCCTTACGGGTCCTCACTGCTGTGGTGGCTTCTTTCTTCATCTGTTGGTTTC
CCTTTCAACTGGTTGCCCTTCTGGGCACCGTCTGGCTCAAAGAGATGTTGTTCTATGGCA
AGTACAAAATCATTGACATCCTGGTTAACCCAACGAGCTCCCTGGCCTTCTTCAACAGCT
GCCTCAACCCCATGCTTTACGTCTTTGTGGGCCAAGACTTCCGAGAGAGACTGATCCACT
CCCTGCCCACCAGTCTGGAGAGGGCCCTGTCTGAGGACTCAGCCCCAACTAATGACACGG
CTGCCAATTCTGCTTCACCTCCTGCAGAGACTGAGTTACAGGCAATGTGAGGATGGGGTC
AGGGATATTTTGAGTTCTGTTCATCCTACCCTATGCCAGTTCCAGCTTCATCTACCCTTG
AGTCATATTGAGGCATTCAAGGATGCACAGCTCAAGTATTTATTCAGGAAAAATGCTTTT
GTGTCCCTGATTTGGGGCTAAGAAATAGACAGTCAGGCTACTAAAATATTAGTGTTATTT
TTTGTTTTTTGACTTCTGCCTATACCCTGGGGTAAGTGGAGTTGGGAAATACAAGAAGAG
AAAGACCAGTGGGGATTTGTAAGACTTAGATGAGATAGCGCATAATAAGGGGAAGACTTT
AAAGTATAAAGTAAAATGTTTGCTGTAGGTTTTTTATAGCTATTAAAAAAAATCAGATTA
TGGAAGTTTTCTTCTATTTTTAGTTTGCTAAGAGTTTTCTGTTTCTTTTTCTTACATCAT
GAGTGGACTTTGCATTTTATCAAATGCATTTTCTACATGTATTAAGATGGTCATATTATT
CTTCTTCTTTTATGTAAATCATTATAAATAATGTTCATTAAGTTCTGAATGTTAAACTAC
TCTTGAATTCCTGGAATAAACCACACTTAGTCCTGATGTACTTTAAATATTTATATCTCA
CAGGAGTTGGTTAGAATTTCTGTGTTTATGTTTATATACTGTTATTTCACTTTTTCTACT
ATCCTTGCTAAGTTTTCATAGAAAATAAGGAACAAAGAGAAACTTGTAATGGTCTCTGAA
AAGGAATTGAGAAGTAATTCCTCTGATTCTGTTTTCTGGTGTTATATCTTTATTAAATAT
TCAGAAAAATTCACCAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AA
5' Read Nucleotide Sequence
>OriGene 5' read for SC322591 unedited
GATCATTTGTATACGACTCCTATAGGGCGGCCGGCGATCGCGGCGCGCCGGTACCGGTCC
GGAATTCCCGGGATGGAAAAGGAGCTTAGCTGCTGGTGCTGCTGGCAAGATGGAAACCAA
CTTCTCCACTCCTCTGAATGAATATGAAGAAGTGTCCTATGAGTCTGCTGGCTACACTGT
TCTGCGGATCCTCCCATTGGTGGTGCTTGGGGTCACCTTTGTCCTCGGGGTCCTGGGCAA
TGGGCTTGTGATCTGGGTGGCTGGATTCCGGATGACACGCACAGTCACCACCATCTGTTA
CCTGAACCTGGCCCTGGCTGACTTTTCTTTCACGGCCACATTACCATTCCTCATTGTCTC
CATGGCCATGGGAGAAAAATGGCCTTTTGGCTGGTTCCTGTGTAAGTTAATTCACATCGT
GGTGGACATCAACCTCTTTGGAAGTGTCTTCTTGATTGGTTTCATTGCACTGGACCGCTG
CATTTGTGTCCTGCATCCAGTCTGGGCCCAGAACCACCGCACTGTGAGTCTGGCCATGAA
GGTGATCGTCGGACCTTGGATTCTTGCTCTAGTCCTTACCTTGCCAGTTTTCCTCTTTTT
GACTACAGTAACTATTCCAAATGGGGACACATACTGTACTTTCAACTTTGCATCCTGGGG
TGGCACCCCTGAGAGAGGCTGAAGGTGGCCATTACCATGCTGACAGCCAGAGGGATTATC
CCGGTTTGTCATTGGCTTTAGCTTGCCGATGTCCATTGTGCCATCTGCTATGGGCTCATT
GCAGCCAGATCCACAAAAAGGGCATGATTAAATCAGCGTCCCTACGGTCCTCACTGCTGT
GGTGGCTTCTTTCTTCATCTGTGTTTCCCTTCACTGATGCCTTCTGGCACCGTCTGCTCA
AGAGATGTTTGTTCTATGGCAAGTTACAAATCTTGACTCTGTTACCTACGAGCTCCGTTA
CCTTTAACAGCTGCCTAACCCAAGGCCTTAA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_001462
ORF Size 1056 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001462.3, NP_001453
RefSeq Size 2019
Locus ID 2358
Cytogenetics 19q13.41
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary Low affinity receptor for N-formyl-methionyl peptides, which are powerful neutrophils chemotactic factors. Binding of FMLP to the receptor causes activation of neutrophils. This response is mediated via a G-protein that activates a phosphatidylinositol-calcium second messenger system. The activation of LXA4R could result in an anti-inflammatory outcome counteracting the actions of proinflammatory signals such as LTB4 (leukotriene B4). [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.