FBP1 (NM_000507) Human Untagged Clone

CAT#: SC322529

FBP1 (untagged)-Human fructose-1,6-bisphosphatase 1 (FBP1), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FBP1 (NM_000507) Human Untagged Clone
Symbol FBP1
Synonyms FBP; FBP
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322529 GCACCACGAGCGCTGCGGACACTCGGGGCGGCAGTCGGTCTGTCAGTCCTCCCGCCAGGT
CCCGCGGCCCGCACCTGCCGCCCGCACCTGCAGCTCCGCACCTGCGGCCAGTGCCTACTG
CCCTCTCTTGCCGCCCGCACCTGCAGCCCCGCACCTGCCGCTTGCACCTGCAGCCCCGCG
CTCTACCCGGTTCAAGCATGGCTGACCAGGCGCCCTTCGACACGGACGTCAACACCCTGA
CCCGCTTCGTCATGGAGGAGGGCAGGAAGGCCCGCGGCACGGGCGAGTTGACCCAGCTGC
TCAACTCGCTCTGCACAGCAGTCAAAGCCATCTCTTCGGCGGTGCGCAAGGCGGGCATCG
CGCACCTCTATGGCATTGCTGGTTCTACCAACGTGACAGGTGATCAAGTTAAGAAGCTGG
ACGTCCTCTCCAACGACCTGGTTATGAACATGTTAAAGTCATCCTTTGCCACGTGTGTTC
TCGTGTCAGAAGAAGATAAACACGCCATCATAGTGGAACCGGAGAAAAGGGGTAAATATG
TGGTCTGTTTTGATCCCCTTGATGGATCTTCCAACATCGATTGCCTTGTGTCCGTTGGAA
CCATTTTTGGCATCTATAGAAAGAAATCAACTGATGAGCCTTCTGAGAAGGATGCTCTGC
AACCAGGCCGGAACCTGGTGGCAGCCGGCTACGCACTGTATGGCAGTGCCACCATGCTGG
TCCTTGCCATGGACTGTGGGGTCAACTGCTTCATGCTGGACCCGGCCATCGGGGAGTTCA
TTTTGGTGGACAAGGATGTGAAGATAAAAAAGAAAGGTAAAATCTACAGCCTTAACGAGG
GCTACGCCAGGGACTTTGACCCTGCCGTCACTGAGTACATCCAGAGGAAGAAGTTCCCCC
CAGATAATTCAGCTCCTTATGGGGCCCGGTATGTGGGCTCCATGGTGGCTGATGTTCATC
GCACTCTGGTCTACGGAGGGATATTTCTGTACCCCGCTAACAAGAAGAGCCCCAATGGAA
AGCTGAGACTGCTGTACGAATGCAACCCCATGGCCTACGTCATGGAGAAGGCTGGGGGAA
TGGCCACCACTGGGAAGGAGGCCGTGTTAGACGTCATTCCCACAGACATTCACCAGAGGG
CGCCGGTGATCTTGGGATCCCCCGACGACGTGCTCGAGTTCCTGAAGGTGTATGAGAAGC
ACTCTGCCCAGTGAGCACCTGCCCTGCCTGCATCCGGAGAATTGCCTCTACCTGGACCTT
TTGTCTCACACAGCAGTACCCTGACCTGCTGTGCACCTTACATTCCTAGAGAGCAGAAAT
AAAAAGCATGACTATTTCCACCATCAAATGCTGTAGAATGCTTGGCACTCCCTAACCAAA
TGCTGTCTCCATAATGCCACTGGTGTTAAGATATATTTTGAGTGGATGGAGGAGAAATAA
ACTTATTCCTCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for SC322529 unedited
GATCTTTGTATACGACTCCTATAGGGCGGCCGGCGATCGCGGCGCGCCGGTACCGGTCCG
GAATTCCCGGGATATCGTCGACCCACGCGTCCGGCACCACGAGCGCTGCGGACACTCGGG
GCGGCAGTCGGTCTGTCAGTCCTCCCGCCAGGTCCCGCGGCCCGCACCTGCCGCCCGCAC
CTGCAGCTCCGCACCTGCGGCCAGTGCCTACTGCCCTCTCTTGCCGCCCGCACCTGCAGC
CCCGCACCTGCCGCTTGCACCTGCAGCCCCGCGCTCTACCCGGTTCAAGCATGGCTGACC
AGGCGCCCTTCGACACGGACGTCAACATTTCTGACCCGCTTCGTCATGGAGGAGGGCAGG
AAGGCCCGCGGCACGGGCGAGTTGACCCAGCTGCTCAACTCGCTCTGCACAGCAGTCAAA
GCCATCTCTTCGGCGGTGCGCAAGGCGGGCATCGCGCACCTCTATGGCATTGCTGGTTCT
ACCAACGTGACAGGTGATCAAGTTAAGAAGCTGGACGTCCTCTCCAACGACCTGGTTATG
AACATGTTAAAGTCATCCTTTGCCACGTGTGTTCTCGTGTCAGAGAAGATAAACACGCCA
TCATAGTGGAACCCGGAGAAAAGGGGTAAATATGTGGTCTGTTTTGATCCCCTTGATGGA
TCTTCCAACATCGATTGCCTTGTGTCCGTTGGAACCATTTTTGGCATCTATAGAAAGAAA
TCAACTGATGAGCCTTCTGAGAATGATGCTCTGCAACCAGGCCCGGACCCTGTGGCAGCC
GGCTACGCACTGTATGGCAGTGCCACCATGCTGTCCTTGCCATGACTGGGGGGTCAACTG
CTTCATGCTGACCGCATCGGGAGTTCATTTGTGACAGATTGTGAAGATAAAAAGAAAGTA
AATTCTACAGCTTACCGAGGCTACGCCAGACTTTGAACCTGCGTACTGGAATCACTCCGA
GGAGAGAGAGTTCCCCCGGATA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_000507
ORF Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000507.2, NP_000498
RefSeq Size 1527
RefSeq ORF 1017
Locus ID 2203
Cytogenetics 9q22.32
Domains FBPase
Protein Families Stem cell - Pluripotency, Druggable Genome
Protein Pathways Glycolysis / Gluconeogenesis, Pentose phosphate pathway, Fructose and mannose metabolism, Metabolic pathways, Insulin signaling pathway
Gene Summary Fructose-1,6-bisphosphatase 1, a gluconeogenesis regulatory enzyme, catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. Fructose-1,6-diphosphatase deficiency is associated with hypoglycemia and metabolic acidosis. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.