IKB beta (NFKBIB) (NM_002503) Human Untagged Clone

CAT#: SC322444

NFKBIB (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 1


  "NM_002503" in other vectors (7)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit anti-NFKBIB Polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "IKB beta"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IKB beta
Synonyms IKBB; TRIP9
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322444 GCGACTGCGGGGGGCCCCTGAGGCGGCGGGGGCCATGGCTGGGGTCGCGTGCTTGGGAAA
AGCTGCCGACGCAGATGAATGGTGCGACAGCGGCCTGGGCTCCCTGGGTCCGGACGCAGC
GGCCCCCGGAGGACCTGGGTTGGGCGCGGAGTTGGGCCCGGGGCTGTCGTGGGCTCCCCT
CGTCTTCGGCTACGTCACTGAGGATGGGGACACGGCACTGCACTTGGCTGTGATTCATCA
GCATGAACCCTTCCTGGATTTTCTTCTAGGCTTCTCGGCCGGCACTGAGTACATGGACCT
GCAGAATGACCTAGGCCAGACAGCCCTGCACCTGGCAGCCATCCTGGGGGAGACATCCAC
GGTGGAGAAGCTGTACGCAGCAGGCGCCGGGCTGTGTGTGGCGGAGCGTAGGGGCCACAC
GGCGCTGCACCTGGCCTGCCGTGTGGGGGCACACGCCTGTGCCCGTGCCCTGCTTCAGCC
CCGCCCCCGGCGCCCCAGGGAAGCCCCCGACACCTACCTCGCTCAGGGCCCTGACCGTAC
TCCCGACACCAACCATACCCCTGTCGCCTTGTACCCCGATTCCGACTTGGAGAAGGAAGA
AGAGGAGAGTGAGGAGGACTGGAAGCTGCAGCTGGAGGCTGAAAACTACGAGGGCCACAC
CCCACTCCACGTGGCCGTTATCCACAAAGATGTGGAGATGGTCCGGCTGCTCCGAGATGC
TGGAGCTGACCTTGACAAACCGGAGCCCACGTGCGGCCGGAGCCCCCTTCATTTGGCAGT
GGAGGCCCAGGCAGCCGATGTGCTGGAGCTTCTCCTGAGGGCAGGCGCGAACCCTGCTGC
CCGCATGTACGGTGGCCGCACCCCACTCGGCAGTGCCATGCTCCGGCCCAACCCCATCCT
CGCCCGCCTCCTCCGTGCACACGGAGCCCCTGAGCCCGAGGGCGAGGACGAGAAATCCGG
CCCCTGCAGCAGCAGTAGCGACAGCGACAGCGGAGACGAGGGCGATGAATACGACGACAT
TGTGGTTCACAGCAGCCGCAGCCAAACCCGGCTGCCTCCCACCCCAGCCTCAAAACCTCT
TCCTGACGACCCCCGCCCCGTGTGATTTGTTTCATTGTTAATATAATTTCCAGTTTAATA
AACAAAACCCTAGTTCTGAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002503
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002503.3, NP_002494.2
RefSeq Size 1198 bp
RefSeq ORF 1071 bp
Locus ID 4793
UniProt ID Q15653
Cytogenetics 19q13.2
Domains ANK
Protein Families Stem cell - Pluripotency, Transcription Factors
Protein Pathways Adipocytokine signaling pathway, B cell receptor signaling pathway, Chemokine signaling pathway, Cytosolic DNA-sensing pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway
Gene Summary The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (1) represents the predominant transcript and encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.