EPCAM (NM_002354) Human Untagged Clone

CAT#: SC322331

EPCAM (untagged)-Human epithelial cell adhesion molecule (EPCAM)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EPCAM (NM_002354) Human Untagged Clone
Symbol EPCAM
Synonyms DIAR5; EGP-2; EGP314; EGP40; ESA; HNPCC8; KS1/4; KSA; M4S1; MIC18; MK-1; TACSTD1; TROP1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322331 CCTTCGGCGAGCGAGCACCTTCGACGCGGTCCGGGGACCCCCTCGTCGCTGTCCTCCCGA
CGCGGACCCGCGTGCCCCAGGCCTCGCGCTGCCCGGCCGGCTCCTCGTGTCCCACTCCCG
GCGCACGCCCTCCCGCGAGTCCCGGGCCCCTCCCGCGCCCCTCTTCTCGGCGCGCGCGCA
GCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTT
TTGCCGCAGCTCAGGAAGAATGTGTCTGTGAAAACTACAAGCTGGCCGTAAACTGCTTTG
TGAATAATAATCGTCAATGCCAGTGTACTTCAGTTGGTGCACAAAATACTGTCATTTGCT
CAAAGCTGGCTGCCAAATGTTTGGTGATGAAGGCAGAAATGAATGGCTCAAAACTTGGGA
GAAGAGCAAAACCTGAAGGGGCCCTCCAGAACAATGATGGGCTTTATGATCCTGACTGCG
ATGAGAGCGGGCTCTTTAAGGCCAAGCAGTGCAACGGCACCTCCACGTGCTGGTGTGTGA
ACACTGCTGGGGTCAGAAGAACAGACAAGGACACTGAAATAACCTGCTCTGAGCGAGTGA
GAACCTACTGGATCATCATTGAACTAAAACACAAAGCAAGAGAAAAACCTTATGATAGTA
AAAGTTTGCGGACTGCACTTCAGAAGGAGATCACAACGCGTTATCAACTGGATCCAAAAT
TTATCACGAGTATTTTGTATGAGAATAATGTTATCACTATTGATCTGGTTCAAAATTCTT
CTCAAAAAACTCAGAATGATGTGGACATAGCTGATGTGGCTTATTATTTTGAAAAAGATG
TTAAAGGTGAATCCTTGTTTCATTCTAAGAAAATGGACCTGACAGTAAATGGGGAACAAC
TGGATCTGGATCCTGGTCAAACTTTAATTTATTATGTTGATGAAAAAGCACCTGAATTCT
CAATGCAGGGTCTAAAAGCTGGTGTTATTGCTGTTATTGTGGTTGTGGTGATAGCAGTTG
TTGCTGGAATTGTTGTGCTGGTTATTTCCAGAAAGAAGAGAATGGCAAAGTATGAGAAGG
CTGAGATAAAGGAGATGGGTGAGATGCATAGGGAACTCAATGCATAACTATATAATTTGA
AGATTATAGAAGAAGGGAAATAGCAAATGGACACAAATTACAAATGTGTGTGCGTGGGAC
GAAGACATCTTTGAAGGTCATGAGTTTGTTAGTTTAACATCATATATTTGTAATAGTGAA
ACCTGTACTCAAAATATAAGCAGCTTGAAACTGGCTTTACCAATCTTGAAATTTGACCAC
AAGTGTCTTATATATGCAGATCTAATGTAAAATCCAGAACTTGGACTCCATCGTTAAAAT
TATTTATGTGTAACATTCAAATGTGTGCATTAAATATGCTTCCACAGTAAAATCTGAAAA
ACTGAAAAAAAAAAAAAA
Restriction Sites SgfI-NotI     
Tag Tag Free
ACCN NM_002354
ORF Size 945 bp
Insert Size 945
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002354.1, NP_002345
RefSeq Size 1528
Locus ID 4072
Cytogenetics 2p21
Domains thyroglobulin_1
Protein Families ES Cell Differentiation/IPS, Transmembrane
Gene Summary This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations