SNAP25 (NM_003081) Human Untagged Clone

CAT#: SC322262

SNAP25 (untagged)-Human synaptosomal-associated protein, 25kDa (SNAP25), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SNAP25 (NM_003081) Human Untagged Clone
Symbol SNAP25
Synonyms bA416N4.2; dJ1068F16.2; RIC-4; RIC4; SEC9; SNAP; SNAP-25
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322262 TGCTCGGCGGCTCCACCACAGTTGCAACCTGCAGAGGCCCGGAGAACACAACCCTCCCGA
GAAGCCCAGGTCCAGAGCCAAACCCGTCACTGACCCCCCAGCCCAGGCGCCCAGCCACTC
CCCACCGCTACCATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGA
AGGGCTGACCAGTTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTT
GAAGAGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAA
CTCGATCGTGTCGAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAA
AATTTAAAAGATTTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAA
TCAAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAG
CCTGCTCGTGTAGTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGG
GTAACAAATGATGCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATC
ATCGGGAACCTCCGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGC
CAGATCGACAGGATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAAC
CAACGTGCAACAAAGATGCTGGGAAGTGGTTAAGTGTGCCCACCCGTGTTCTCCTCCAAA
TGCTGTCGGGCAAGATAGCTCCTTCATGCTTTTCTCATGGTATTATCTAGTAGGTCTGCA
CACATAACACACATCAGTCCACCCCCATTGTGAATGTTGTCCTGTGTCATCTGTCAGCTT
CCCAACAATACTTTGTGTCTTTTGTTCTCTCTTGGTCTCTTTCTTTCCAAAGGTTGTACA
TAGTGGTCATTTGGTGGCTCTAACTCCTTGATGTCCTGAGTTTCATTTTTCATTTTCTCT
CCTCGGTGGCATTTGCTGAATAACAACAATTTAGGAATGCTCAATGTGCTGTTGATTCTT
TCAATCCACAGTATTGTTCTTGTAAAACTGTGACATTCCACAGAGTTACTGCCACGGTCC
TTTGAGTGTCAGGCTCTGAATCTCTCAAAATGTGCCGTCTTTGGTTCCTCATGGCTGTTA
TCTGTCTTTATGATTTCATGATTAGACAATGTGGAATTACATAACAGGCATTGCACTAAA
AGTGATGTGATTTATGCATTTATGCATGAGAACTAAATAGATTTTTAGATTCCTACTTAA
ACAAAAACTTTCCATGACAGTAGCATACTGATGAGACAACACACACACACACAAAACAAC
AGCAACAACAACAGAACAACAACAAAGCATGCTCAGTATTGAGACACTGTCAAGATTAAG
TTATACCAGCAAAAGTGCAGTAGTGTCACTTTTTTCCTGTCAATATATAGAGACTTCTAA
ATCATAATCATCCTTTTTTAAAAAAAAGAATTTTAAAAAAGATGGATTTGACACACTCAC
CATTTAATCATTTCCAGCAAAATATATGTTTGGCTGAAATTATGTCAAATGGATGTAATA
TAGGGTTTGTTTGCTGCTTTTGATGGCTACGTTTTGGAGAGAGCAATCTTGCTGTGAAAC
AGTGTGGATGTAAATTTTATAAGGCTGACTCTTACTAACCACCATTTCCCCTGTGGTTTG
TTATCAGTACAATTCTTTGTTGCTTAATCTAGAGCTATGCACACCAAATTGCTGAGATGT
TTAGTAGCTGATAAAGAAACCTTTTAAAAAAATAATATAAATGAATGAAATATAAACTGT
GAGATAAATATCATTATAGCATGTAATATTAAATTCCTCCTGTCTCCTCTGTCAGTTTGT
GAAGTGATTGACATTTTGTAGCTAGTTTAAAATTATTAAAAATTATAGACTCCAAAAAAA
AAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for SC322262 unedited
TGCCATTGTATACGACTCCTATAGGGCGGCCGGCGATCGCGGCGCGCCGGTACCGGTCCG
GAATTCCCGGGATATCGTCGACCCACGCGTCCGCCCACGCGTCCGTGCTCGGCGGCTCCA
CCACAGTTGCAACCTGCAGAGGCCCGGAGAACACAACCCTCCCGAGAAGCCCAGGTCCAG
AGCCAAACCCGTCACTGACCCCCCAGCCCAGGCGCCCAGCCACTCCCCACCGCTACCATG
GCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAGTTG
GCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAAGAT
GCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTCGATCGTGTCGAA
GAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAAAATTTAAAAGATTTA
GGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCTTAC
AAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTAGTG
GACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGATGCC
CGAGAAAATGAAATGGATGAAAACCTAGAGCAGTGAGCGGCATCATCGGGAACCTCCGTC
ACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGGATCA
TGGAGAAGCTGATTCCAACAAAACCAGATTGATGAGCCAACCAACGTGCAACAAAGATGC
TGGGAAGTGGTTAGTGTGGCCCACCGTGTCTCCCTCCAATGCTGTCGGCAGATAGCTCCT
CATGCTTTCTCATGGTATTATCTAGTAGTTCTGCCCACGACCACCACTCAGTCCACCCAT
TGGTGAATGTGTGTGGTCCTGGTCAAC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_003081
ORF Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003081.2, NP_003072
RefSeq Size 2053
Locus ID 6616
Cytogenetics 20p12.2
Domains t_SNARE, SNAP-25
Protein Families Druggable Genome
Protein Pathways SNARE interactions in vesicular transport
Gene Summary Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) contains 8 exons and encodes isoform SNAP25A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.