POLR1D (NM_015972) Human Untagged Clone
CAT#: SC322230
POLR1D (untagged)-Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1
"NM_015972" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | POLR1D |
Synonyms | AC19; POLR1C; RPA9; RPA16; RPAC2; RPC16; RPO1-3; TCS2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322230
GCCTTCCGTCGGTCGGTCCTTGCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAG
AGCCCCCGATCCGCCAGCACCACCTGAGGATCCAGAAACCGCCCCAGCGATGGAAGAGGA TCAGGAGCTGGAGAGAAAAATATCTGGATTGAAGACCTCAATGGCTGAAGGCGAGAGGAA GACAGCCCTGGAAATGGTCCAGGCAGCTGGAACAGATAGACACTGTGTGACATTTGTATT GCACGAGGAAGACCATACCCTAGGAAATTCTCTACGTTACATGATCATGAAGAACCCGGA AGTGGAATTTTGTGGTTACACTACGACCCATCCTTCAGAGAGCAAAATTAATTTACGCAT TCAGACTCGAGGTACCCTTCCAGCTGTTGAGCCATTTCAGAGAGGCCTGAATGAGCTCAT GAATGTCTGCCAACATGTGCTTGACAAGTTTGAGGCCAGCATAAAGGACTATAAGGATCA AAAAGCAAGCAGAAATGAATCCACATTCTAGTCCTTTATGCAGTATACAAGGAGAACTGT CCTGTAGGATATTCTCTTCCTGATGGTGCAGAACCCAGAATTAGAAGTTTGTGGTTACAG CATACTCTGTCCTTCAGAAAGGCGTGATTCTAGCTGTTGACCCCTTGCAGCTGTTGGAAT CTCTGCAAGAACCTCTGTATTCTTCTAATAAATTCCCTCTTTTATTTAAACTAAAAAAAA AAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_015972 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_015972.1, NP_057056.1 |
RefSeq Size | 726 bp |
RefSeq ORF | 402 bp |
Locus ID | 51082 |
UniProt ID | P0DPB6 |
Cytogenetics | 13q12.2 |
Domains | RNA_pol_L |
Protein Families | Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
Gene Summary | The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011] Transcript Variant: This variant (1) represents the shortest transcript but encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201466 | POLR1D (Myc-DDK-tagged)-Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1 |
USD 150.00 |
|
RC201466L1 | Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, Myc-DDK-tagged |
USD 450.00 |
|
RC201466L2 | Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, mGFP tagged |
USD 450.00 |
|
RC201466L3 | Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, Myc-DDK-tagged |
USD 450.00 |
|
RC201466L4 | Lenti ORF clone of Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1, mGFP tagged |
USD 450.00 |
|
RG201466 | POLR1D (tGFP-tagged) - Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1 |
USD 350.00 |
|
SC108711 | POLR1D (untagged)-Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review