VPS37A (NM_152415) Human Untagged Clone

CAT#: SC322101

Reviews ()
Write a review

VPS37A (untagged)-Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 1

  View "NM_152415" in other vectors (11)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 740.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name VPS37A (NM_152415) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol VPS37A
Synonyms HCRP1; PQBP2; SPG53
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322101 TGTGGTCGGTTTGGGCGTCTGGGCCGTGAAGGTGGGACCTCCTGTTCCGGGCCGCAAGTT
TCCCTCTCCAGCCGCCCGCCGTTCGTAGCATGTCCCCCAGAACTCGGGGAGCGCAGGCAG
GACAGGCTTAGAGAAGACGCGGTCCCCAGCGCTTGGGCCACGGACGTCCCACCCCGCTCC
TCTGTCGCTGGAGAACCGCCGGGCCGAGCCACTGGGAGAAGCAGGCCAGAGCCTTCCAGG
GCCTCCGGCCCGTGGACCCGAGGAGGATGAGCTGGCTTTTTCCCCTGACCAAGAGCGCCT
CCTCCTCCGCGGCTGGGTCCCCCGGTGGCCTCACCAGCCTCCAGCAGCAGAAGCAGCGCC
TGATCGAGTCCCTCCGGAACTCACACTCCAGTATAGCCGAAATACAGAAAGATGTGGAAT
ACAGATTGCCATTCACCATAAACAACCTGACAATTAACATTAATATACTGCTTCCTCCAC
AGTTTCCTCAGGAAAAACCAGTGATCAGTGTTTATCCACCAATACGACATCACTTAATGG
ATAAACAAGGAGTGTATGTTACCTCTCCATTAGTAAACAATTTTACAATGCACTCAGATC
TTGGAAAAATTATTCAGAGTCTGTTGGATGAGTTTTGGAAGAATCCTCCAGTTTTAGCTC
CTACTTCAACAGCATTTCCTTATCTATACAGTAACCCAAGTGGGATGTCTCCTTATGCTT
CTCAGGGTTTTCCATTTCTTCCTCCATATCCTCCACAAGAAGCAAACAGGAGTATCACTT
CTTTATCTGTTGCTGACACTGTTTCTTCTTCAACAACAAGTCATACCACAGCCAAGCCTG
CCGCTCCTTCATTTGGTGTCCTTTCAAATCTGCCATTACCCATTCCCACAGTGGATGCTT
CAATACCGACAAGCCAAAATGGTTTTGGGTACAAGATGCCAGATGTCCCTGATGCATTTC
CAGAACTCTCAGAACTAAGTGTGTCACAACTCACAGATATGAATGAACAAGAGGAGGTAT
TACTAGAACAGTTTCTGACTTTGCCTCAACTAAAACAAATTATTACCGACAAAGATGACT
TAGTAAAAAGTATTGAGGAACTAGCAAGAAAAAATCTCCTTTTGGAGCCCAGCTTGGAAG
CCAAAAGACAAACTGTTTTAGATAAGTATGAATTACTTACACAGATGAAGTCCACTTTCG
AAAAGAAGATGCAAAGGCAGCATGAACTTAGTGAGATCTGTAGTGCAAGTGCCCTTCAGG
CAAGATTGAAAGTAGCTGCACATGAAGCTGAGGAAGAATCTGATAATATTGCAGAAGATT
TCTTGGAGGGAAAGATGGAAATAGATGATTTTCTCAGTAGCTTCATGGAAAAGAGAACAA
TTTGCCACTGTAGAAGAGCCAAGGAAGAGAAACTTCAGCAGGCGATAGCAATGCACAGCC
AATTTCATGCTCCACTATAGATTTTCCTGGAAACATGAACTGCCAAGAGAGGAATGGGAC
ACAAAACCAAACACTGTTTTATATTTATGGTTTGCAAACTGGCATTTCATCAGTGGCTAA
ATTCACAGATATCCTATATAGATTGTATACAGAACTGAGACTGATTTTGTACCGATTAGA
ATGATTGCTATGATCTTTGAGAAATTTTTCTGCACTATTTGCACTGAAATGTTTATTTAT
TGTTGATAAATTGTATCATATTTAAGTTCCACTGCTGTTCCTCTTACCTTGATTAAATGC
CTATGCATGTACTTTTAGCTAGTTTTTAATATTTTATAAAACTTCATTTAAATTTGTATT
TTTAACTTGAAGTTCCATTTCTTTATCAAGGATGGTATTTAGATTTTTTTCCTCTTAACC
TTTTTTCAAAAACTATTTTCAACTGTGAGGAAACCCTTATTTTTCTTTCTTTGTGGATAA
AACTTTCAAAAGCAATTTAAGATATTCATAGTGTTAGGAAACACCAAACCTGCCTATGTG
CAATCTCACAAAAGAAACTTTTAATACCTACAATAAATCAAAAGAATAAACCAAAAAAAA
AAAAAAAA
>OriGene 5' read for SC322101 unedited
GGCCTTTGTATACGACTCCTATAGGGCGGCCGCACAACTTCGTATAGCATACATTATACG
AAGTTATGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGAGCGTGTGGTCGGTTT
GGGCGTCTGGGCCGTGAAGGTGGGACCTCCTGTTCCGGGCCGCAAGTTTCCCTCTCCAGC
CGCCCGCCGTTCGTAGCATGTCCCCCAGAACTCGGGGAGCGCAGGCAGGACAGGCTTAGA
GAAGACGCGGTCCCCAGCGCTTGGGCCACGGACGTCCCACCCCGCTCCTCTGTCGCTGGA
GAACCGCCGGGCCGAGCCACTGGGAGAAGCTTTTTCAGAGCCTTCCAGGGCCTCCGGCCC
GTGGACCCGAGGAGGATGAGCTGGCTTTTTCCCCTGACCAAGAGCGCCTCCTCCTCCGCG
GCTGGGTCCCCCGGTGGCCTCACCAGCCTCCAGCAGCAGAAGCAGCGCCTGATCGAGTCC
CTCCGGAACTCACACTCCAGTATAGCCGAAATACAGAAAGATGTGGAATACAGATTGCCA
TTCACCATAAACAACCTGACAATTAACATTAATATACTGCTTCCTCCACAGTTTCCTCAG
GAAAAACCAGTGATCAGTGTTTATCCACCAATACGACATCACTTAATGGATAAACAAAGG
AGTGTATGTTACCTCTCCATTAGTAAACAATTTTACAATGCACTCAGATCTTGGAAAAAT
TATTCAGAGTCTGTTGGATGAGTTTTGGAAGAATCCTCCAGTTTTAGCTCCTACTTCAAC
AGCATTTCCTTATTCTTATACAGTAACCCAAGTGGGATGTCTCCTATGCTCTCAGGGTTT
TTCCATTTCTTCCTCATATCCTCCACAAGAAGCAAACAGGAGTATCACTTCTTTATCTGT
TGCTGACACCTGTTTCTTCTCAACAAACAGGTCATACCACAGCAGGCTGGCGATCATTCA
ATGGGTCCTGCATCTTGCCATACCATTCCCACAGTGAGATGGCCTCTCCA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_152415
ORF Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_152415.1, NP_689628
RefSeq Size 2020
RefSeq ORF 1194
Locus ID 137492
Cytogenetics 8p22
Protein Pathways Endocytosis
Gene Summary This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Other products for "VPS37A"
Frequently bought together (2)
Rabbit Polyclonal Anti-VPS37A Antibody
    • 100 ul

USD 335.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones