MTCH1 (NM_014341) Human Untagged Clone

CAT#: SC322048

MTCH1 (untagged)-Human mitochondrial carrier 1 (MTCH1), nuclear gene encoding mitochondrial protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MTCH1
• Synonyms: CGI-64; PIG60; PSAP; SLC25A49
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_014341, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAGCTTCGGACCCGGAAGTGGCGCCCTGGGCTCGCGGCGGTGCCGCGGGGATGGCGGGAGCCGGAG
  CTGGAGCCGGAGCTCGCGGCGGAGCGGCGGCGGGGGTCGAGGCTCGAGCTCGCGATCCACCGCCCGCGCA
  CCGCGCACATCCTCGCCACCCTCGGCCTGCGGCTCAGCCCTCGGCCCGCAGGATGGATGGCGGGTCAGGG
  GGCCTGGGGTCTGGGGACAACGCCCCGACCACTGAGGCTCTTTTCGTGGCACTGGGCGCGGGCGTGACGG
  CGCTCAGCCATCCCCTGCTCTACGTGAAGCTGCTCATCCAGGTGGGTCATGAGCCGATGCCCCCCACCCT
  TGGGACCAATGTGCTGGGGAGGAAGGTCCTCTATCTGCCGAGCTTCTTCACCTACGCCAAGTACATCGTG
  CAAGTGGATGGTAAGATAGGGCTGTTCCGAGGCCTGAGTCCCCGGCTGATGTCCAACGCCCTCTCTACTG
  TGACTCGGGGTAGCATGAAGAAGGTTTTCCCTCCAGATGAGATTGAGCAGGTTTCCAACAAGGATGATAT
  GAAGACTTCCCTGAAGAAAGTTGTGAAGGAGACCTCCTACGAGATGATGATGCAGTGTGTGTCCCGCATG
  TTGGCCCACCCCCTGCATGTCATCTCAATGCGCTGCATGGTCCAGTTTGTGGGACGGGAGGCCAAGTACA
  GTGGTGTGCTGAGCTCCATTGGGAAGATTTTCAAAGAGGAAGGGCTGCTGGGATTCTTCGTTGGATTAAT
  CCCTCACCTCCTGGGCGATGTGGTTTTCTTGTGGGGCTGTAACCTGCTGGCCCACTTCATCAATGCCTAC
  CTGGTGGATGACAGCTTCAGCCAGGCCCTGGCCATCCGGAGCTATACCAAGTTCGTGATGGGGATTGCAG
  TGAGCATGCTGACCTACCCCTTCCTGCTAGTTGGCGACCTCATGGCTGTGAACAACTGCGGGCTGCAAGC
  TGGGCTCCCCCCTTACTCCCCAGTGTTCAAATCCTGGATTCACTGCTGGAAGTACCTGAGTGTGCAGGGC
  CAGCTCTTCCGAGGCTCCAGCCTGCTTTTCCGCCGGGTGTCATCAGGATCATGCTTTGCCCTGGAGTAA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_014341
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_014341.1, NP_055156.1
• RefSeq Size: 1890 bp
• RefSeq ORF: 1119 bp
• Locus ID: 23787
• UniProt ID: Q9NZJ7
• Cytogenetics: 6p21.2
• Domains: mito_carr
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the mitochondrial carrier family. The encoded protein is localized to the mitochondrion inner membrane and induces apoptosis independent of the proapoptotic proteins Bax and Bak. Pseudogenes on chromosomes 6 and 11 have been identified for this gene. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Oct 2012]
  Transcript Variant: This variant (1) encodes the shorter isoform (PSAP-LS, PMID 18291114). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.