KPNA2 (NM_002266) Human Untagged Clone

CAT#: SC321886

KPNA2 (untagged)-Human karyopherin alpha 2 (RAG cohort 1, importin alpha 1) (KPNA2)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name KPNA2 (NM_002266) Human Untagged Clone
Symbol KPNA2
Synonyms IPOA1; QIP2; RCH1; SRP1-alpha; SRP1alpha
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002266.2 GAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCTACAGCCGCTGATTCCCCCCGC
ATCGCCTCCCGTGGAAGCCCAGGCCCGCTTCGCAGCTTTCTCCCTTTGTCTCATAACCAT
GTCCACCAACGAGAATGCTAATACACCAGCTGCCCGTCTTCACAGATTCAAGAACAAGGG
AAAAGACAGTACAGAAATGAGGCGTCGCAGAATAGAGGTCAATGTGGAGCTGAGGAAAGC
TAAGAAGGATGACCAGATGCTGAAGAGGAGAAATGTAAGCTCATTTCCTGATGATGCTAC
TTCTCCGCTGCAGGAAAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACAT
TGTCAAAGGCATAAATAGCAGCAATGTGGAAAATCAGCTCCAAGCTACTCAAGCTGCCAG
GAAACTACTTTCCAGAGAAAAACAGCCCCCCATAGACAACATAATCCGGGCTGGTTTGAT
TCCGAAATTTGTGTCCTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGC
TTGGGCACTCACTAACATTGCTTCTGGGACATCAGAACAAACCAAGGCTGTGGTAGATGG
AGGTGCCATCCCAGCATTCATTTCTCTGTTGGCATCTCCCCATGCTCACATCAGTGAACA
AGCTGTCTGGGCTCTAGGAAACATTGCAGGTGATGGCTCAGTGTTCCGAGACTTGGTTAT
TAAGTACGGTGCAGTTGACCCACTGTTGGCTCTCCTTGCAGTTCCTGAGATGTCATCTTT
AGCATGTGGCTACTTACGTAATCTTACCTGGACACTTTCTAATCTTTGCCGCAACAAGAA
TCCTGCACCCCCGATAGATGCTGTTGAGCAGATTCTTCCTACCTTAGTTCGGCTCCTGCA
TCATGATGATCCAGAAGTGTTAGCAGATACCTGCTGGGCTATTTCCTACCTTACTGATGG
TCCAAATGAACGAATTGGCATGGTGGTGAAAACAGGAGTTGTGCCCCAACTTGTGAAGCT
TCTAGGAGCTTCTGAATTGCCAATTGTGACTCCTGCCCTAAGAGCCATAGGGAATATTGT
CACTGGTACAGATGAACAGACTCAGGTTGTGATTGATGCAGGAGCACTCGCCGTCTTTCC
CAGCCTGCTCACCAACCCCAAAACTAACATTCAGAAGGAAGCTACGTGGACAATGTCAAA
CATCACAGCCGGCCGCCAGGACCAGATACAGCAAGTTGTGAATCATGGATTAGTCCCATT
CCTTGTCAGTGTTCTCTCTAAGGCAGATTTTAAGACACAAAAGGAAGCTGTGTGGGCCGT
GACCAACTATACCAGTGGTGGAACAGTTGAACAGATTGTGTACCTTGTTCACTGTGGCAT
AATAGAACCGTTGATGAACCTCTTAACTGCAAAAGATACCAAGATTATTCTGGTTATCCT
GGATGCCATTTCAAATATCTTTCAGGCTGCTGAGAAACTAGGTGAAACTGAGAAACTTAG
TATAATGATTGAAGAATGTGGAGGCTTAGACAAAATTGAAGCTCTACAAAACCATGAAAA
TGAGTCTGTGTATAAGGCTTCGTTAAGCTTAATTGAGAAGTATTTCTCTGTAGAGGAAGA
GGAAGATCAAAACGTTGTACCAGAAACTACCTCTGAAGGCTACACTTTCCAAGTTCAGGA
TGGGGCTCCTGGGACCTTTAACTTTTAGATCATGTAGCTGAGACATAAATTTGTTGTGTA
CTACGTTTGGTATTTTGTCTTATTGTTTCTCTACTAAGAACTCTTTCTTAAATGTGGTTT
GTTACTGTAGCACTTTTTACACTGAAACTATACTTGAACAGTTCCAACTGTACATACATA
CTGTATGAAGCTTGTCCTCTGACTAGGTTTCTAATTTCTATGTGGAATTTCCTATCTTGC
AGCATCCTGTAAATAAACATTCAAGTCCACCCTTTTCTTGACTTCAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002266.2 unedited
TACATTTGTATACGACTCCTATAGGGCGGCCGGCGATCGCGGCGCGCCGGTACCGGTCCG
GAATTCCCGGGATATCGTCGACCCACGCGTCCGCCCACGCGTCCGGAGCTGAGTCGAGGT
GGACCCTTTGAACGCAGTCGCCCTACAGCCGCTGATTCCCCCCGCATCGCCTCCCGTGGA
AGCCCAGGCCCGCTTCGCAGCTTTCTCCCTTTGTCTCATAACCATGTCCACCAACGAGAA
TGCTAATACACCAGCTGCCCGTCTTCACAGATTCAAGAACAAGGGAAAAGACAGTACAGA
AATGAGGCGTCGCAGAATAGAGGTCAATGTGGAGCTGAGGAAAGCTAAGAAGGATGACCA
GATGCTGAAGAGGAGAAATGTAAGCTCATTTCCTGATGATGCTACTTCTCCGCTGCAGGA
AAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACATTGTCAAAGGCATAAA
TAGCAGCAATGTGGAAAATCAGCTCCAAGCTACTCAAGCTGCCAGGAAACTACTTTCCAG
AGAAAAACAGCCCCCCATAGACAACATAATCCGGGCTGGTTTGATTCCGAAATTTGTGTC
CTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGCTTGGGCACTCACTAA
CATTGCTTCTGGGACATCAGACAAACCACGCTGTGGTAGATGGAGTGCCATCCCAGCATT
CATTTCTCTGTTGGCATCTCCCCATGCTCACATCAGTGAACAAGCTGTCTGGGCTCTTAG
AAACATTGCAGTGATGGCTCACTGTTCCGAGACTGGTTATTAAGTACGTGCAGTTGACCA
CTGTGGCCTCTCCTTGCAGTCCTGAAAATGGTCATCTTAGACATGTGGCTACTTACGTAT
CTACTGCAACCTTTCTAATCTTGCCGCAACAAGTATCCTGCCACCCCGATTAATATCGTG
TAGAACAGTATCTGCTCATCACCGTG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_002266
ORF Size 1590 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002266.2, NP_002257
RefSeq Size 2011
RefSeq ORF 1590
Locus ID 3838
Cytogenetics 17q24.2
Domains ARM, IBB
Protein Families Stem cell - Pluripotency, Druggable Genome
Gene Summary The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016].
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations