EXOSC3 (NM_016042) Human Untagged Clone

CAT#: SC321585

EXOSC3 (untagged)-Human exosome component 3 (EXOSC3), transcript variant 1


  "NM_016042" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
EXOSC3 mouse monoclonal antibody, clone OTI1D6 (formerly 1D6)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "EXOSC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EXOSC3
Synonyms bA3J10.7; CGI-102; hRrp-40; p10; PCH1B; RRP40; Rrp40p
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_016042.2 GTGGAGCCCGCGATGGCCGAACCTGCGTCTGTCGCGGCTGAATCTCTCGCGGGCAGCAGG
GCGCGCGCTGCACGCACAGTACTAGGTCAGGTGGTGCTCCCGGGTGAGGAGCTGCTCCTG
CCGGAACAGGAGGACGCGGAAGGCCCTGGGGGTGCAGTGGAGCGACCGTTGAGCCTGAAT
GCTAGAGCGTGCTCGCGGGTGCGCGTTGTATGCGGTCCGGGCCTTCGGCGCTGTGGGGAC
CGCCTGCTGGTCACCAAGTGCGGCCGCCTCCGTCACAAGGAGCCCGGCAGTGGCAGCGGC
GGCGGTGTTTACTGGGTGGACTCTCAGCAGAAGCGGTATGTTCCAGTAAAAGGAGACCAT
GTGATTGGCATAGTGACAGCTAAATCTGGAGATATATTCAAAGTTGATGTTGGAGGGAGT
GAGCCAGCTTCTTTGTCTTACTTGTCATTTGAAGGTGCAACTAAAAGAAACAGACCAAAT
GTGCAGGTTGGAGATCTCATCTATGGCCAATTTGTGGTTGCTAATAAAGACATGGAACCA
GAGATGGTCTGTATTGACAGCTGTGGACGAGCCAATGGAATGGGTGTCATTGGACAGGAT
GGTCTGCTTTTTAAAGTGACTCTGGGCTTAATTAGAAAGCTATTAGCTCCAGATTGTGAA
ATCATACAGGAAGTGGGAAAACTCTATCCACTGGAGATAGTATTTGGAATGAATGGAAGA
ATATGGGTTAAGGCAAAAACCATCCAGCAGACTTTAATTTTGGCAAACATTTTAGAAGCT
TGTGAACACATGACGTCAGATCAAAGAAAACAGATCTTCTCCAGATTGGCAGAAAGTTGA
TATAGGTGGACTTTTTTACAGGTCAGTTGAGGCAAAAAACTATGGGTTTTTTCAGGTGAA
CCTCCCCCATTTAAATACTCAGAAGATAAGGTGTGAATGTATGTATTATTAGAGTCCGAA
AGTATTTTTATAAGTTACTGGTTTTCACCCACGCTTTTGTGGGAGAGAAAATCATTGCAA
AATCATTTTTTTTGTTCGGTACAATAAAGTTTACTAAAAAACAGTAAAAAAAAAAAAAAA
AAA
Restriction Sites Please inquire     
ACCN NM_016042
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016042.2, NP_057126.2
RefSeq Size 1220 bp
RefSeq ORF 828 bp
Locus ID 51010
UniProt ID Q9NQT5
Cytogenetics 9p13.2
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation
Gene Summary This gene encodes a non-catalytic component of the human exosome, a complex with 3'-5' exoribonuclease activity that plays a role in numerous RNA processing and degradation activities. Related pseudogenes of this gene are found on chromosome 19 and 21. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.