LAPTM4A (NM_014713) Human Untagged Clone

CAT#: SC321578

Reviews ()
Write a review

LAPTM4A (untagged)-Human lysosomal protein transmembrane 4 alpha (LAPTM4A)



  "NM_014713" in other vectors (6)

Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "LAPTM4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LAPTM4A
Synonyms HUMORF13; LAPTM4; MBNT; Mtrp
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_014713.3 CGCGAAGAAGCTGGCAGGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGTTGGGTTT
TGGAGGCCGTGAAACAGCCGTTTGAGTTTGGCTGCGGGTGGAGAACGTTTGTCAGGGGCC
CGGCCAAGAAGGAGGCCCGCCTGTTACGATGGTGTCCATGAGTTTCAAGCGGAACCGCAG
TGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATCAT
CCTGGGGACCTGGTACATGGTAGTAAACCTATTGATGGCAATTTTGCTGACTGTGGAAGT
GACTCATCCAAACTCCATGCCAGCTGTCAACATTCAGTATGAAGTCATCGGTAATTACTA
TTCTTCTGAGAGAATGGCTGATAATGCCTGTGTTCTTTTTGCCGTCTCTGTTCTTATGTT
TATAATCAGTTCAATGCTGGTTTATGGATCAATTTCTTATCAAGTGGGTTGGCTGATTCC
ATTCTTCTGTTACCGACTTTTTGACTTCGTCCTCAGTTGCCTGGTTGCTATTAGTTCTCT
CACCTATTTGCCAAGAATCAAAGAATATCTGGATCAACTACCTGATTTTCCCTACAAAGA
TGACCTCCTGGCCTTGGACTCCAGCTGCCTCCTGTTCATTGTTCTTGTGTTCTTTGCCTT
ATTCATCATTTTTAAGGCTTATCTAATTAACTGTGTTTGGAACTGCTATAAATACATCAA
CAACCGAAACGTGCCGGAGATTGCTGTGTACCCTGCCTTTGAAGCACCTCCTCAGTACGT
TTTGCCAACCTATGAAATGGCCGTGAAAATGCCTGAAAAAGAACCACCACCTCCTTACTT
ACCTGCCTGAAGAAATTCTGCCTTTGACAATAAATCCTATACCAGCTTTTTGTTTGTTTA
TGTTACAGAATGCTGCAATTCAGGGCTCTTCAAACTTGTTTGATATAAAATATGTTGTCT
TTTGTTTAAGCATTTATTTTCAAACACTAAGGAGCTTTTTGACATCTGTTAAACGTCTTT
TTGTTTTTTTGTTAAGTCTTTTACATTTTAATAGTTTTTGAAGACAATCTAGGTTAAGCA
AGAGCAAAGTGCCATTGTTTGCCTTTAATTGGGGGGTGGGAAGGGAAAGAGGGTACTTGC
CACATAGTTTCCTTTTTAACTGCACTTTCTTTATATAATCGTTTGCATTTTGTTACTTGC
TACCCTGAGTACTTTCAGGAAGACTGACTTAAATATTCGGGGTGAGTAAGTAGTTGGGTA
TAAGATCTGAACTTTTCATCTGCAGAGGCAAGAAAAATATTTGACATTGTGACTTGACTG
TGGAAGATGATGGTTGCATGTTTCTAGTTTGTATATGTTTCCATCTTTGTGATAAGATGA
TTTAATAAATCTCTTTAAATACTTAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_014713
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014713.3, NP_055528.1
RefSeq Size 1419 bp
RefSeq ORF 702 bp
Locus ID 9741
UniProt ID Q15012
Cytogenetics 2p24.1
Domains Mtp
Protein Families Transmembrane
Protein Pathways Lysosome
Gene Summary This gene encodes a protein that has four predicted transmembrane domains. The function of this gene has not yet been determined; however, studies in the mouse homolog suggest a role in the transport of small molecules across endosomal and lysosomal membranes. [provided by RefSeq, Jul 2008]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.