hnRNP K(HNRNPK) (NM_002140) Human Untagged Clone

CAT#: SC321563

HNRNPK (untagged)-Human heterogeneous nuclear ribonucleoprotein K (HNRNPK), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name hnRNP K(HNRNPK) (NM_002140) Human Untagged Clone
Symbol HNRNPK
Synonyms CSBP; HNRPK; TUNP
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002140.2 CGGCAGTCTCGCGCGGCTACTGCAGCACTGGGGTGTCAGTTGTTGGTCCGACCCAGAACG
CTTCAGTTCTGCTCTGCAAGGATATATAATAACTGATTGGTGTGCCCGTTTAATAAAAGA
ATATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTG
GTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTG
ATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAA
AAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAG
ACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAA
TTCTGAAGAAAATCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAA
CCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGAATGCTTAAATTACCAACACTATAAAG
GAAGTGACTTTGACTGCGAGTTGAGGCTGTTGATTCATCAGAGTCTAGCAGGAGGAATTA
TTGGGGTCAAAGGTGCTAAAATCAAAGAACTTCGAGAGAACACTCAAACCACCATCAAGC
TTTTCCAGGAATGCTGTCCTCATTCCACTGACAGAGTTGTTCTTATTGGAGGAAAACCCG
ATAGGGTTGTAGAGTGCATAAAGATCATCCTTGATCTTATATCTGAGTCTCCCATCAAAG
GACGTGCACAGCCTTATGATCCCAATTTTTACGATGAAACCTATGATTATGGTGGTTTTA
CAATGATGTTTGATGACCGTCGCGGACGCCCAGTGGGATTTCCCATGCGGGGAAGAGGTG
GTTTTGACAGAATGCCTCCTGGTCGGGGTGGGCGTCCCATGCCTCCATCTAGAAGAGATT
ATGATGATATGAGCCCTCGTCGAGGACCACCTCCCCCTCCTCCCGGACGAGGCGGCCGGG
GTGGTAGCAGAGCTCGGAATCTTCCTCTTCCTCCACCACCACCACCTAGAGGGGGAGACC
TCATGGCCTATGACAGAAGAGGGAGACCTGGAGACCGTTACGACGGCATGGTTGGTTTCA
GTGCTGATGAAACTTGGGACTCTGCAATAGATACATGGAGCCCATCAGAATGGCAGATGG
CTTATGAACCACAGGGTGGCTCCGGATATGATTATTCCTATGCAGGGGGTCGTGGCTCAT
ATGGTGATCTTGGTGGACCTATTATTACTACACAAGTAACTATTCCCAAAGATTTGGCTG
GATCTATTATTGGCAAAGGTGGTCAGCGGATTAAACAAATCCGTCATGAGTCGGGAGCTT
CGATCAAAATTGATGAGCCTTTAGAAGGATCCGAAGATCGGATCATTACCATTACAGGAA
CACAGGACCAGATACAGAATGCACAGTATTTGCTGCAGAACAGTGTGAAGCAGTATGCAG
ATGTTGAAGGATTCTAATGCAAGATATTTTTTCTTTTTTATAGTGTGAAGCAGTATTCTG
GAAAGTTTTTCTAAGACTAGTGAAGAACTGAAGGAGTCCTGCATCTTTTTTTTTTTATCT
GCTTCTGTTTAAAAAGCCAACATTCCTCTGCTTCATAGGTGTTCTGCATTTGAGGTGTAG
TGAAATCTTTGCTGTTCACCAGATGTAATGTTTTAGTTCCTTACAAACAGGGTTGGGGGG
GGGAAGGGCGTGCAAAAACTAACATTGAAATTTTGAAACAGCAGCAGAGTGAGTGGATTT
TATTTTTCGTTATTGTTGGTGGTTTAAAAAATTCCCCCCATGTAATTATTGTGAACACCT
TGCTTTGTGGTCACTGTAACATTTGGGGGGTGGGACAGGGAGGAAAAGTAACAATAGTCC
ACATGTCCCTGGCATCTGTTCAGAGCAGTGTGCAGAATGTAATGCTCTTTTGTAAGAAAC
GTTTTATGATTTTTAAAATAAATTTAGTGAACCTAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002140.2 unedited
GACATTTGTATACGACTCCTATAGGGCGGGCGGGAATTCGGCACGAGGCGGCAGTCTCGC
GCGGCTACTGCAGCACTGGGGTGTCAGTTGTTGGTCCGACCCAGAACGCTTCAGTTCTGC
TCTGCAAGGATATATAATAACTGATTGGTGTGCCCGTTTAATAAAAGAATATGGAAACTG
AACAGCCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTG
CAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTG
AATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGA
ATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCC
CCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAA
TCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCC
CGCTCGAATCTGATGCTGTGGAATGCTTAAATTACCAACACTATAAAGGAAGTGACTTTG
ACTGCGAGTTGAGGCTGTTGATTCATCAGAGTCTAGCAGAGGAATTATTGGGGTCAAAGG
TGCTAAAATCAAAGAACTTCGAGAGAACACTCAAACCACCATCAAGCTTTTCCAGGAATG
CTGTCCTCATTCCACTGACAGAGTTGTTCTTATTGGAGGAAAACCCGATAGGGTTGTAGA
GTGCATAAAGATCATCCTTGATCTTATAATTCTGGAGTCTCCATCAAAGACGTGCACAGC
CTTATGATCCCAATTTTTACGATGAAACTATGATATGGTGGTTTTACAATGATGTTTGAT
GACCGTCGCGACGCCAGTGGGAATTCCATGGCGGGAAAAGTGTGTTTTGG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_002140
ORF Size 1395 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002140.2, NP_002131
RefSeq Size 2830
RefSeq ORF 1395
Locus ID 3190
Cytogenetics 9q21.32
Domains KH
Protein Pathways Spliceosome
Gene Summary This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference; it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript. Transcript variants 1 and 2 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations