EIF4EL3 (EIF4E2) (NM_004846) Human Untagged Clone

CAT#: SC321530

EIF4E2 (untagged)-Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2)


  "NM_004846" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
EIF4E2 mouse monoclonal antibody, clone OTI1F11 (formerly 1F11)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "EIF4EL3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EIF4EL3
Synonyms 4E-LP; 4EHP; EIF4EL3; h4EHP; IF4e
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_004846.2 GGGACCCGGTGGAGCGGAAGTCACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGAT
GAACAACAAGTTCGACGCTTTGAAAGATGATGACAGTGGGGACCATGATCAGAATGAAGA
AAACAGCACACAGAAAGATGGTGAGAAGGAAAAAACGGAACGAGACAAGAATCAGAGCAG
TAGCAAGAGAAAGGCTGTTGTCCCTGGACCGGCAGAGCATCCCCTGCAGTACAACTACAC
TTTTTGGTACTCCAGGAGAACCCCCGGCCGTCCCACGAGCTCACAGAGCTATGAACAGAA
TATCAAACAGATTGGCACCTTTGCCTCTGTGGAGCAGTTCTGGAGGTTTTATAGCCACAT
GGTACGTCCTGGGGACCTGACAGGCCACAGTGACTTCCATCTCTTCAAAGAAGGAATTAA
ACCCATGTGGGAGGATGATGCAAATAAAAATGGTGGCAAGTGGATTATTCGGCTGCGGAA
GGGCTTGGCCTCCCGTTGCTGGGAGAATCTCATTTTGGCCATGCTGGGGGAACAGTTCAT
GGTTGGGGAGGAGATCTGTGGGGCTGTGGTGTCTGTCCGCTTTCAGGAAGACATTATTTC
AATATGGAATAAGACTGCCAGTGACCAAGCAACCACAGCCCGAATCCGGGACACACTTCG
GCGAGTGCTTAACCTACCTCCCAACACCATTATGGAATACAAAACTCACACCGACAGCAT
CAAAATGCCAGGCAGGCTGGGCCCCCAAAGGCTCCTTTTTCAAAACCTCTGGAAGCCGCG
GTTGAATGTGCCATGACCCTCTCCCTCTCTGGATGGCACCATCATTGAAGCTGGCGTCAT
CGGAGTCTCTTGTTCTGTTGGCGTGCTACCTGGAAGATCCTTCTGTCCTGGACAAGAGGA
ATTGGAAGAGCATTTTATGTTTTAAGAACAGGCTGACACGCAGCAGCTACAACAACAGCT
GAGATCACTTAATAAATGGTGCTAAACTAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004846
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004846.2, NP_004837.1
RefSeq Size 1014 bp
RefSeq ORF 738 bp
Locus ID 9470
UniProt ID O60573
Cytogenetics 2q37.1
Domains IF4E
Protein Families Transcription Factors
Protein Pathways Insulin signaling pathway, mTOR signaling pathway
Gene Summary Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation (PubMed:9582349, PubMed:17368478, PubMed:25624349). Acts as a repressor of translation initiation (PubMed:22751931). In contrast to EIF4E, it is unable to bind eIF4G (EIF4G1, EIF4G2 or EIF4G3), suggesting that it acts by competing with EIF4E and block assembly of eIF4F at the cap (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (A).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.