P2Y6 (P2RY6) (NM_176797) Human Untagged Clone

CAT#: SC320606

Reviews ()
Write a review

P2RY6 (untagged)-Human pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 1


Product Datasheet for 'SC320606'


  "NM_176797" in other vectors (5)

Need a mutant or fragment? Switch to a different vector? Get a free quote.

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name P2Y6 (P2RY6) (NM_176797) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol P2RY6
Synonyms P2Y6
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_176797.1 GCTGCTTGCCAGCTCTGTGCTGTGGCAAGTTACTTCCTCTCCCCAGGTCTCTCGGTTTCC
TCATCTGCTGCCTCTCCAGACTTCTGCCAGAACATTGCACGCGACAGTTTCAGGCACAGA
ACTGACTGGCAGCAGGGGCTGCTCCACGAGTGGGAATTTGCTCCAGCACTTCACGGACTG
CAAGCGAGGCACTTGCTAACTCTTGGCCTCCCTGAACATAGGAAACCCACCTGGGCAGCC
ATGGAATGGGACAATGGCACAGGCCAGGCTCTGGGCTTGCCACCCACCACCTGTGTCTAC
CGCGAGAACTTCAAGCAACTGCTGCTGCCACCTGTGTATTCGGCGGTGCTGGCGGCTGGC
CTGCCGCTGAACATCTGTGTCATTACCCAGATCTGCACGTCCCGCCGGGCCCTGACCCGC
ACGGCCGTGTACACCCTAAACCTTGCTCTGGCTGACCTGCTATATGCCTGCTCCCTGCCC
CTGCTCATCTACAACTATGCCCAAGGTGATCACTGGCCCTTTGGCGACTTCGCCTGCCGC
CTGGTCCGCTTCCTCTTCTATGCCAACCTGCACGGCAGCATCCTCTTCCTCACCTGCATC
AGCTTCCAGCGCTACCTGGGCATCTGCCACCCGCTGGCCCCCTGGCACAAACGTGGGGGC
CGCCGGGCTGCCTGGCTAGTGTGTGTAGCCGTGTGGCTGGCCGTGACAACCCAGTGCCTG
CCCACAGCCATCTTCGCTGCCACAGGCATCCAGCGTAACCGCACTGTCTGCTATGACCTC
AGCCCGCCTGCCCTGGCCACCCACTATATGCCCTATGGCATGGCTCTCACTGTCATCGGC
TTCCTGCTGCCCTTTGCTGCCCTGCTGGCCTGCTACTGTCTCCTGGCCTGCCGCCTGTGC
CGCCAGGATGGCCCGGCAGAGCCTGTGGCCCAGGAGCGGCGTGGCAAGGCGGCCCGCATG
GCCGTGGTGGTGGCTGCTGCCTTTGCCATCAGCTTCCTGCCTTTTCACATCACCAAGACA
GCCTACCTGGCAGTGCGCTCGACGCCGGGCGTCCCCTGCACTGTATTGGAGGCCTTTGCA
GCGGCCTACAAAGGCACGCGGCCGTTTGCCAGTGCCAACAGCGTGCTGGACCCCATCCTC
TTCTACTTCACCCAGAAGAAGTTCCGCCGGCGACCACATGAGCTCCTACAGAAACTCACA
GCCAAATGGCAGAGGCAGGGTCGCTGAGTCCTCCAGGTCCTGGGCAGCCTTCATATTTGC
CATTGTGTCCGGGGCACCAGGAGCCCCACCAACCCCAAACCATGCGGAGAATTAGAGTTC
AGCTCAGCTGGGCATGGAGTTAAGATCCCTCACAGGACCCAGAAGCTCACCAAAAACTAT
TTCTTCAGCCCCTTCTCTGGCCCAGACCCTGTGGGCATGGAGATGGACAGACCTGGGCCT
GGCTCTTGAGAGGTCCCAGTCAGCCATGGAGAGCTGGGGAAACCACATTAAGGTGCTCAC
AAAAATACAGTGTGACGTGTACTGTCAAAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_176797.1 unedited
CACCATTGTATACGACTCCTATAGGGCGGCCGGGAATTCGGCACGAGGGCTGCTTGCCAG
CTCTGTGCTGTGGCAAGTTACTTCCTCTCCCCAGGTCTCTCGGTTTCCTCATCTGCTGCC
TCTCCAGACTTCTGCCAGAACATTGCACGCGACAGTTTCAGGCACAGAACTGACTGGCAG
CAGGGGCTGCTCCACGAGTGGGAATTTGCTCCAGCACTTCACGGACTGCAAGCGAGGCAC
TTGCTAACTCTTGGCCTCCCTGAACATAGGAAACCCACCTGGGCAGCCATGGAATGGGAC
AATGGCACAGGCCAGGCTCTGGGCTTGCCACCCACCACCTGTGTCTACCGCGAGAACTTC
AAGCAACTGCTGCTGCCACCTGTGTATTCGGCGGTGCTGGCGGCTGGCCTGCCGCTGAAC
ATCTGTGTCATTACCCAGATCTGCACGTCCCGCCGGGCCCTGACCCGCACGGCCGTGTAC
ACCCTAAACCTTGCTCTGGCTGACCTGCTATATGCCTGCTCCCTGCCCCTGCTCATCTAC
AACTATGCCCAAGGTGATCACTGGCCCTTTGGCGACTTCGCCTGCCGCCTGGTCCGCTTC
CTCTTCTATGCCAACCTGCACGGCAGCATCCTCTTCCTCACCTGCATCAGCTTCCAGCGC
TACCTGGGCATCTGCCACCCGCTGGCCCCCTGGCACAAACGTGGGGGCCGCCGGGCTGCC
TGACTAGTGTGTGTAGCCGTGTGGCTGGCCGTGACAACCCAGTGCCTGCCCACAGACATC
TTCGCTGCCACAGGCATCCAGCGTAACCGCACTGTCTGCTATGACCTCAGCCCGCCTGCC
TGCCACCCCACTATATGCCCTATGACATGCTTCTCACTGTCATCGGCTCCTGGCTGCCCT
TGCTGCCCTGGCTGGCCTGGTAACATGTCTCCTGC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_176797
ORF Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_176797.1, NP_789767.1
RefSeq Size 1555
RefSeq ORF 987
Locus ID 5031
Cytogenetics 11q13.4
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (1) represents the shortest transcript. Variants 1,2,3,5,6,7, and 8 encode the same isoform (1).

Other Versions

Other products for "P2RY6"
Frequently bought together (2)
P2RY6 Rabbit Polyclonal Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools