Grp75(HSPA9) (NM_004134) Human Untagged Clone

CAT#: SC320242

HSPA9 (untagged)-Human heat shock 70kDa protein 9 (mortalin) (HSPA9), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Grp75(HSPA9) (NM_004134) Human Untagged Clone
Symbol HSPA9
Synonyms CSA; GRP-75; GRP75; HEL-S-124m; HSPA9B; MOT; MOT2; MTHSP75; PBP74
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004134.4 GGAGCGCTTGTTTGCTGCCTCGTACTCCTCCATTTATCCGCCATGATAAGTGCCAGCCGA
GCTGCAGCAGCCCGTCTCGTGGGCGCCGCAGCCTCCCGGGGCCCTACGGCCGCCCGCCAC
CAGGATAGCTGGAATGGCCTTAGTCATGAGGCTTTTAGACTTGTTTCAAGGCGGGATTAT
GCATCAGAAGCAATCAAGGGAGCAGTTGTTGGTATTGATTTGGGTACTACCAACTCCTGC
GTGGCAGTTATGGAAGGTAAACGAGCAAAGGTGCTGGAGAATGCCGAAGGTGCCAGAACC
ACCCCTTCAGTTGTGGCCTTTACAGCAGATGGTGAGCGACTTGTTGGAATGCCGGCCAAG
CGACAGGCTGTCACCAACCCAAACAATACATTTTATGCTACCAAGCGTCTCATTGGCCGG
CGATATGATGATCCTGAAGTACAGAAAGACATTAAAAATGTTCCCTTTAAAATTGTCCGT
GCCTCCAATGGTGATGCCTGGGTTGAGGCTCATGGGAAATTGTATTCTCCGAGTCAGATT
GGAGCATTTGTGTTGATGAAGATGAAAGAGACTGCAGAAAATTACTTGGGGCGCACAGCA
AAAAATGCTGTGATCACAGTCCCAGCTTATTTCAATGACTCGCAGAGACAGGCCACTAAA
GATGCTGGCCAGATATCTGGACTGAATGTGCTTCGGGTGATTAATGAGCCCACAGCTGCT
GCTCTTGCCTATGGTCTAGACAAATCAGAAGACAAAGTCATTGCTGTATATGATTTAGGT
GGTGGAACTTTTGATATTTCTATCCTGGAAATTCAGAAAGGAGTATTTGAGGTGAAATCC
ACAAATGGGGATACCTTCTTAGGTGGGGAAGACTTTGACCAGGCCTTGCTACGGCACATT
GTGAAGGAGTTCAAGAGAGAGACAGGGGTTGATTTGACTAAAGACAACATGGCACTTCAG
AGGGTACGGGAAGCTGCTGAAAAGGCTAAGTGTGAACTCTCCTCATCTGTGCAGACTGAC
ATCAATTTGCCCTATCTTACAATGGATTCTTCTGGACCCAAGCATTTGAATATGAAGTTG
ACCCGTGCTCAATTTGAAGGGATTGTCACTGATCTAATCAGAAGGACTATCGCTCCATGC
CAAAAAGCTATGCAAGATGCAGAAGTCAGCAAGAGTGACATAGGAGAAGTGATTCTTGTG
GGTGGCATGACTAGGATGCCCAAGGTTCAGCAGACTGTACAGGATCTTTTTGGCAGAGCC
CCAAGTAAAGCTGTCAATCCTGATGAGGCTGTGGCCATTGGAGCTGCCATTCAGGGAGGT
GTGTTGGCCGGCGATGTCACGGATGTGCTGCTCCTTGATGTCACTCCCCTGTCTCTGGGT
ATTGAAACTCTAGGAGGTGTCTTTACCAAACTTATTAATAGGAATACCACTATTCCAACC
AAGAAGAGCCAGGTATTCTCTACTGCCGCTGATGGTCAAACGCAAGTGGAAATTAAAGTG
TGTCAGGGTGAAAGAGAGATGGCTGGAGACAACAAACTCCTTGGACAGTTTACTTTGATT
GGAATTCCACCAGCCCCTCGTGGAGTTCCTCAGATTGAAGTTACATTTGACATTGATGCC
AATGGGATAGTACATGTTTCTGCTAAAGATAAAGGCACAGGACGTGAGCAGCAGATTGTA
ATCCAGTCTTCTGGTGGATTAAGCAAAGATGATATTGAAAATATGGTTAAAAATGCAGAG
AAATATGCTGAAGAAGACCGGCGAAAGAAGGAACGAGTTGAAGCAGTTAATATGGCTGAA
GGAATCATTCACGACACAGAAACCAAGATGGAAGAATTCAAGGACCAATTACCTGCTGAT
GAGTGCAACAAGCTGAAAGAAGAGATTTCCAAAATGAGGGAGCTCCTGGCTAGAAAAGAC
AGCGAAACAGGAGAAAATATTAGACAGGCAGCATCCTCTCTTCAGCAGGCATCATTGAAG
CTGTTCGAAATGGCATACAAAAAGATGGCATCTGAGCGAGAAGGCTCTGGAAGTTCTGGC
ACTGGGGAACAAAAGGAAGATCAAAAGGAGGAAAAACAGTAATAATAGCAGAAATTTTGA
AGCCAGAAGGACAACATATGAAGCTTAGGAGTGAAGAGACTTCCTGAGCAGAAATGGGCG
AACTTCAGTCTTTTTACTGTGTTTTTGCAGTATTCTATATATAATTTCCTTAATTTGTAA
ATTTAGTGACCATTAGCTAGTGATCATTTAATGGACAGTGATTCTAACAGTATAAAGTTC
ACAATATTCTATGTCCCTAGCCTGTCATTTTTCAGCTGCATGTAAAAGGAGGTAGGATGA
ATTGATCATTATAAAGATTTAACTATTTTATGCTGAAGTGACCATATTTTCAAGGGGTGA
AACCATCTCGCACACAGCAATGAAGGTAGTCATCCATAGACTTGAAATGAGACCACATAT
GGGGATGAGATCCTTCTAGTTAGCCTAGTACTGCTGTACTGGCCTGTATGTACATGGGGT
CCTTCAACTGAGGCCTTGCAAGTCAAGCTGGCTGTGCCATGTTTGTAGATGGGGCAGAGG
AATCTAGAACAATGGGAAACTTAGCTATTTATATTAGGTACAGCTATTAAAACAAGGTAG
GAATGAGGCTAGACCTTTAACTTCCCTAAGGCATACTTTTCTAGCTACCTTCTGCCCTGT
GTCTGGCACCTACATCCTTGATGATTGTTCTCTTACCCATTCTGGAATTTTTTTTTTTTT
TAAATAAATACAGAAAGCATCTTGAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004134.4 unedited
GGGCGCTGTGTAGACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACC
GAGGAGATCTGCCGCCGCGATCGCGGCGCGCCAGATCTCAAGCTTAACTAGTTAGCGGAC
CGACGCGTTAAGCGGCCGCGAATTCAGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTA
AAACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGC
ACGAGGGGAGCGCTTGTTTGCTGCCTCGTACTCCTCCATTTATCCGCCATGATAAGTGCC
AGCCGAGCTGCAGCAGCCCGTCTCGTGGGCGCCGCAGCCTCCCGGGGCCCTACGGCCGCC
CGCCACCAGGATAGCTGGAATGGCCTTAGTCATGAGGCTTTTAGACTTGTTTCAAGGCGG
GATTATGCATCAGAAGCAATCAAGGGAGCAGTTGTTGGTATTGATTTGGGTACTACCAAC
TCCTGCGTGGCAGTTATGGAAGGTAAACGAGCAAAGGTGCTGGAGAATGCCGAAGGTGCC
AGAACCACCCCTTCAGTTGTGGCCTTTACAGCAGATGGTGAGCGACTTGTTGGAATGCCG
GCCAAGCGACAGGCTGTCACCAACCCAAACAATACATTTTATGCTACCAAGCGTCTCATT
GGCCCGGCGATATGATGATCCTGAAGTACAGAAAGACATTAAAAATGTTCCCTTTAAAAT
TGTCCGTGCCTCCAATGGTGATGCCTGGGTTGAGCTCATGGGAAATTGTATTCTCCGAGT
CAGATTGGAGCATTTGTTGTTGATGAAGATGAAAGAAGACTGCAGAAAATACTGGGGCGC
CACAAGCAAAAAATGCTTGTGGATCACAGTCCCAGCTTATTTCCATGACCTCGCAGAGAT
AGGCCACTAAGATGCTGCAGATTTCTGACTGGATGTGTCTTCGGGTGATATGACCAAGCT
GCGTG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_004134
ORF Size 2040 bp
Insert Size 2800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004134.4, NP_004125
RefSeq Size 2883
RefSeq ORF 2040
Locus ID 3313
Cytogenetics 5q31.2
Domains HSP70
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation
Gene Summary This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.