Pirin (PIR) (NM_001018109) Human Untagged Clone

CAT#: SC320195

PIR (untagged)-Human pirin (iron-binding nuclear protein) (PIR), transcript variant 2


  "NM_001018109" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-PIR Antibody
    • 100 ul

USD 485.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pirin"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Pirin
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001018109.1 CTTCGCGTCACCCCCGCCGCTAAGGCTCCAGGTGCCGCTACCGCAGCCCCTCCATCCTCT
ACAGCTCAGCATCAGAACACTCTCTTTTTAGACTCCGATATGGGGTCCTCCAAGAAAGTT
ACTCTCTCAGTGCTCAGCCGGGAGCAGTCGGAAGGGGTTGGAGCGAGGGTCCGGAGAAGC
ATTGGCAGACCCGAGTTAAAAAATCTGGATCCGTTTTTACTGTTTGATGAATTTAAAGGA
GGTAGACCAGGAGGATTTCCTGATCATCCACATCGAGGTTTTGAAACAGTATCCTACCTC
CTGGAAGGGGGCAGCATGGCCCATGAAGACTTCTGTGGACACACTGGTAAAATGAACCCA
GGAGATTTGCAGTGGATGACTGCGGGCCGGGGCATTCTGCACGCTGAGATGCCTTGCTCA
GAGGAGCCAGCCCATGGCCTACAACTGTGGGTTAATTTGAGGAGCTCAGAGAAGATGGTG
GAGCCTCAGTACCAGGAACTGAAAAGTGAAGAAATCCCTAAACCCAGTAAGGATGGTGTG
ACAGTTGCTGTCATTTCTGGAGAAGCCCTGGGAATAAAGTCCAAGGTTTACACTCGCACA
CCAACCTTATATTTGGACTTCAAATTGGACCCAGGAGCCAAACATTCCCAACCTATCCCT
AAAGGGTGGACAAGCTTCATTTACACGATATCTGGAGATGTGTATATTGGGCCCGATGAT
GCACAACAAAAAATAGAACCTCATCACACAGCAGTGCTTGGAGAAGGTGACAGTGTCCAG
GTGGAGAACAAGGATCCCAAGAGAAGCCACTTTGTCTTAATTGCTGGGGAGCCATTAAGA
GAACCAGTTATCCAACATGGTCCATTTGTGATGAACACCAATGAAGAGATTTCTCAAGCT
ATTCTTGATTTCAGAAACGCAAAAAATGGGTTTGAAAGGGCCAAAACCTGGAAATCAAAG
ATTGGGAACTAGTGGAAAGCGGAAGAGCAGGTCTTGATGTGTCCTAGAATTTTGCCATTT
CTGAGATTGAGCCATTGAAGGCATTCCATTTCTAAAGCTTATTTAGCCGGTGCTTCTAAA
GAATTCCACACTAACGTGATAACATGGTTTTTGTAACAATAAATGTAGGATATTTCCTGG
CACATGCAAATAAACCTAATCATTGTTTCTTTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001018109
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018109.1, NP_001018119.1
RefSeq Size 1282 bp
RefSeq ORF 873 bp
Locus ID 8544
UniProt ID O00625
Cytogenetics Xp22.2
Protein Families Transcription Factors
Gene Summary This gene encodes a member of the cupin superfamily. The encoded protein is an Fe(II)-containing nuclear protein expressed in all tissues of the body and concentrated within dot-like subnuclear structures. Interactions with nuclear factor I/CCAAT box transcription factor as well as B cell lymphoma 3-encoded oncoprotein suggest the encoded protein may act as a transcriptional cofactor and be involved in the regulation of DNA transcription and replication. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate, in-frame splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.