PPP1R14A (NM_033256) Human Untagged Clone
CAT#: SC319588
PPP1R14A (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A)
"NM_033256" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPP1R14A |
Synonyms | CPI-17; CPI17; PPP1INL |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_033256.1
CTGGGTCCAGCAGCGCGATGGCAGCTCAGCGGCTGGGCAAGCGCGTGCTGAGCAAGCTGC
AGTCTCCATCGCGGGCCCGCGGGCCAGGGGGCAGTCCCGGGGGGCTGCAGAAGCGGCACG CGCGCGTCACCGTCAAGTATGACCGGCGGGAGCTGCAGCGGCGGCTGGACGTGGAGAAGT GGATCGACGGGCGCCTGGAGGAGCTGTACCGCGGCATGGAGGCAGACATGCCCGATGAGA TCAACATTGATGAATTGTTGGAGTTAGAGAGTGAAGAGGAGAGAAGCCGGAAAATCCAGG GACTCCTGAAGTCATGTGGGAAACCTGTCGAGGACTTCATCCAGGAGCTGCTGGCAAAGC TTCAAGGCCTCCACAGGCAGCCCGGCCTCCGCCAGCCAAGCCCCTCCCACGACGGCAGCC TCAGCCCCCTCCAGGACCGGGCCCGGACTGCTCACCCCTGACCCTCTTGCACTCTCCCTG CCCCCCGGACGCCGCCCAGCTTGCTTGTGTATAAGTTGTATTTAATGGTTCTGTAACAAT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_033256 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033256.1, NP_150281.1 |
RefSeq Size | 723 bp |
RefSeq ORF | 444 bp |
Locus ID | 94274 |
UniProt ID | Q96A00 |
Cytogenetics | 19q13.2 |
Domains | PP1_inhibitor |
Protein Families | Druggable Genome |
Protein Pathways | Vascular smooth muscle contraction |
Gene Summary | The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1, also known as CPI-17alpha). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205799 | PPP1R14A (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A) |
USD 150.00 |
|
RC205799L1 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), Myc-DDK-tagged |
USD 450.00 |
|
RC205799L2 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), mGFP tagged |
USD 450.00 |
|
RC205799L3 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), Myc-DDK-tagged |
USD 450.00 |
|
RC205799L4 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), mGFP tagged |
USD 450.00 |
|
RG205799 | PPP1R14A (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review