ACTC1 (NM_005159) Human Untagged Clone

CAT#: SC319325

Reviews ()
Write a review

ACTC1 (untagged)-Human actin, alpha, cardiac muscle 1 (ACTC1)



  "NM_005159" in other vectors (4)

USD 433.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name ACTC1 (NM_005159) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol ACTC1
Synonyms ACTC; ASD5; CMD1R; CMH11; LVNC4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_005159.4 CCTCGGCAGTCCTAGCGGGTGCGAAGGGGACCAAATAAGGCAAGGTGGCAGACCGGGCCC
CCCACCCCTGCCCCCGGCTGCTCCAACTGACCCTGTCCATCAGCGTTCTATAAAGCGGCC
CTCCTGGAGCCAGCCACCCAGAGCCCGCTGCCGCCGGAGCCGAGCCGACCCGCCCCGCCG
ACGAACCCCCTGAAGCTGTGCCAAGATGTGTGACGACGAGGAGACCACCGCCCTGGTGTG
CGACAACGGCTCTGGGCTGGTGAAGGCCGGCTTTGCGGGCGATGACGCGCCCCGCGCTGT
CTTCCCGTCCATCGTGGGCCGCCCGCGGCACCAGGGAGTTATGGTGGGTATGGGTCAGAA
GGACTCCTACGTAGGTGATGAAGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTATCC
CATCGAGCATGGTATCATCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTT
CTACAATGAGCTCCGTGTGGCTCCCGAGGAGCACCCCACCCTGCTCACAGAGGCCCCGCT
GAACCCCAAGGCCAACCGGGAGAAGATGACTCAGATCATGTTTGAGACCTTCAATGTCCC
TGCCATGTACGTGGCCATCCAGGCAGTGCTATCCCTGTATGCTTCTGGCCGTACCACAGG
CATTGTTCTGGACTCTGGGGATGGTGTAACTCACAATGTCCCCATCTATGAGGGCTACGC
TTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGTCGGGACCTCACTGACTACCTCAT
GAAGATCCTCACTGAGCGTGGCTACTCCTTTGTCACCACTGCTGAACGTGAAATTGTCCG
TGACATTAAAGAGAAGCTGTGCTATGTCGCCCTGGATTTTGAGAATGAGATGGCCACAGC
TGCCTCTTCCTCCTCCCTGGAGAAGAGCTATGAACTGCCTGATGGCCAAGTCATCACTAT
TGGCAATGAGCGCTTCCGCTGTCCTGAGACACTCTTCCAGCCCTCCTTCATTGGTATGGA
ATCTGCTGGCATCCATGAAACAACTTACAATAGCATCATGAAGTGTGACATTGATATCCG
CAAGGACCTGTATGCCAACAATGTCTTATCTGGAGGCACCACTATGTACCCTGGTATTGC
TGATCGTATGCAGAAGGAAATCACTGCTCTGGCTCCTAGCACCATGAAGATTAAGATTAT
TGCTCCCCCTGAGCGTAAATACTCTGTCTGGATTGGGGGCTCCATCCTGGCCTCTCTGTC
CACCTTCCAGCAAATGTGGATTAGCAAGCAAGAGTACGATGAGGCAGGCCCATCCATTGT
CCACCGCAAATGCTTCTAAGATGCCTTCTCTCTCCATCTACCTTCCAGTCAGGATGACGG
TATTATGCTTCTTGGAGTCTTCCAAACCACCTTCCCTCATCTTTCATCAATCATTGTACA
GTTTGTTTACACACGTGCAATTTGTTTGTGCTTCTAATATTTATTGCTTTATAAATAAAC
CAGACCAGGACTTGCAACCTAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_005159
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005159.4, NP_005150.1
RefSeq Size 3693 bp
RefSeq ORF 1134 bp
Locus ID 70
Cytogenetics 15q14
Domains ACTIN
Protein Pathways Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM)
Gene Summary Actins are highly conserved proteins that are involved in various types of cell motility. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to four others. The protein encoded by this gene belongs to the actin family which is comprised of three main groups of actin isoforms, alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. Defects in this gene have been associated with idiopathic dilated cardiomyopathy (IDC) and familial hypertrophic cardiomyopathy (FHC). [provided by RefSeq, Jul 2008]

Other Versions

Other products for "ACTC1"
Frequently bought together (2)
Rabbit monoclonal antibody against Actin (Pan)(EP184E)
    • 100 ul

USD 524.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools