Neuroserpin (SERPINI1) (NM_001122752) Human Untagged Clone

SKU
SC318861
SERPINI1 (untagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Neuroserpin
Synonyms HNS-S1; HNS-S2; neuroserpin; PI12
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001122752, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTCCTTGGACTCTTCTCTTTGCTGGTTCTGCAAAGTATGGCTACAGGGGCCACT
TTCCCTGAGGAAGCCATTGCTGACTTGTCAGTGAATATGTATAATCGTCTTAGAGCCACT
GGTGAAGATGAAAATATTCTCTTCTCTCCATTGAGTATTGCTCTTGCAATGGGAATGATG
GAACTTGGGGCCCAAGGATCTACCCAGAAAGAAATCCGCCACTCAATGGGATATGACAGC
CTAAAAAATGGTGAAGAATTTTCTTTCTTGAAGGAGTTTTCAAACATGGTAACTGCTAAA
GAGAGCCAATATGTGATGAAAATTGCCAATTCCTTGTTTGTGCAAAATGGATTTCATGTC
AATGAGGAGTTTTTGCAAATGATGAAAAAATATTTTAATGCAGCAGTAAATCATGTGGAC
TTCAGTCAAAATGTAGCCGTGGCCAACTACATCAATAAGTGGGTGGAGAATAACACAAAC
AATCTGGTGAAAGATTTGGTATCCCCAAGGGATTTTGATGCTGCCACTTATCTGGCCCTC
ATTAATGCTGTCTATTTCAAGGGGAACTGGAAGTCGCAGTTTAGGCCTGAAAATACTAGA
ACCTTTTCTTTCACTAAAGATGATGAAAGTGAAGTCCAAATTCCAATGATGTATCAGCAA
GGAGAATTTTATTATGGGGAATTTAGTGATGGCTCCAATGAAGCTGGTGGTATCTACCAA
GTCCTAGAAATACCATATGAAGGAGATGAAATAAGCATGATGCTGGTGCTGTCCAGACAG
GAAGTTCCTCTTGCTACTCTGGAGCCATTAGTCAAAGCACAGCTGGTTGAAGAATGGGCA
AACTCTGTGAAGAAGCAAAAAGTAGAAGTATACCTGCCCAGGTTCACAGTGGAACAGGAA
ATTGATTTAAAAGATGTTTTGAAGGCTCTTGGAATAACTGAAATTTTCATCAAAGATGCA
AATTTGACAGGCCTCTCTGATAATAAGGAGATTTTTCTTTCCAAAGCAATTCACAAGTCC
TTCCTAGAGGTTAATGAAGAAGGCTCAGAAGCTGCTGCTGTCTCAGGAATGATTGCAATT
AGTAGGATGGCTGTGCTGTATCCTCAAGTTATTGTCGACCATCCATTTTTCTTTCTTATC
AGAAACAGGAGAACTGGTACAATTCTATTCATGGGACGAGTCATGCATCCTGAAACAATG
AACACAAGTGGACATGATTTCGAAGAACTT
Restriction Sites Please inquire
ACCN NM_001122752
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001122752.1, NP_001116224.1
RefSeq Size 1696 bp
RefSeq ORF 1233 bp
Locus ID 5274
UniProt ID Q99574
Cytogenetics 3q26.1
Protein Families Druggable Genome, Secreted Protein
Summary This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.
Write Your Own Review
You're reviewing:Neuroserpin (SERPINI1) (NM_001122752) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225640 SERPINI1 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 10 ug
$503.00
RC225640L3 Lenti-ORF clone of SERPINI1 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 10 ug
$803.00
RC225640L4 Lenti-ORF clone of SERPINI1 (mGFP-tagged)-Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 10 ug
$803.00
RG225640 SERPINI1 (tGFP-tagged) - Human serpin peptidase inhibitor, clade I (neuroserpin), member 1 (SERPINI1), transcript variant 2 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.