MSF (SEPT9) (NM_001113496) Human Untagged Clone

CAT#: SC318832

41526 (untagged)-Human septin 9 (SEPT9), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MSF
• Synonyms: AF17q25; MSF; MSF1; NAPB; PNUTL4; SEPT9; SeptD1; SINT1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC318832 representing NM_001113496.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCCGACACCCCCAGAGATGCCGGGCTCAAGCAGGCGCCTGCATCACGGAACGAGAAGGCCCCGGTG
  GACTTCGGCTACGTGGGGATTGACTCCATCCTGGAGCAGATGCGCCGGAAGGCCATGAAGCAGGGCTTC
  GAGTTCAACATCATGGTGGTCGGGCAGAGCGGCTTGGGTAAATCCACCTTAATCAACACCCTCTTCAAA
  TCCAAAATCAGCCGGAAGTCGGTGCAGCCCACCTCAGAGGAGCGCATCCCCAAGACCATCGAGATCAAG
  TCCATCACGCACGATATTGAGGAGAAAGGCGTCCGGATGAAGCTGACAGTGATTGACACACCAGGGTTC
  GGGGACCACATCAACAACGAGAACTGCTGGCAGCCCATCATGAAGTTCATCAATGACCAGTACGAGAAA
  TACCTGCAGGAGGAGGTCAACATCAACCGCAAGAAGCGCATCCCGGACACCCGCGTCCACTGCTGCCTC
  TACTTCATCCCCGCCACCGGCCACTCCCTCAGGCCCCTGGACATCGAGTTTATGAAACGCCTGAGCAAG
  GTGGTCAACATCGTCCCTGTCATCGCCAAGGCGGACACACTCACCCTGGAGGAGAGGGTCCACTTCAAA
  CAGCGGATCACCGCAGACCTGCTGTCCAACGGCATCGACGTGTACCCCCAGAAGGAATTTGATGAGGAC
  TCGGAGGACCGGCTGGTGAACGAGAAGTTCCGGGAGATGATCCCATTTGCTGTGGTGGGCAGTGACCAC
  GAGTACCAGGTCAACGGCAAGAGGATCCTTGGGAGGAAGACCAAGTGGGGTACCATCGAAGTTGAAAAC
  ACCACACACTGTGAGTTTGCCTACCTGCGGGACCTTCTCATCAGGACGCACATGCAGAACATCAAGGAC
  ATCACCAGCAGCATCCACTTCGAGGCGTACCGTGTGAAGCGCCTCAACGAGGGCAGCAGCGCCATGGCC
  AACGGCATGGAGGAGAAGGAGCCAGAAGCCCCGGAGATGTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001113496
• Insert Size: 1008 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001113496.1
• RefSeq Size: 3246 bp
• RefSeq ORF: 1008 bp
• Locus ID: 10801
• UniProt ID: Q9UHD8
• Cytogenetics: 17q25.3
• Protein Families: Druggable Genome
• MW: 38.5 kDa
• Gene Summary: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
  Transcript Variant: This variant (7, also known as delta) lacks three 5' exons, but has an alternate 5' exon, which results in a downstream AUG start codon, as compared to variant 1. The resulting isoform (f) has a much shorter N-terminus, as compared to isoform a.