Filamin C(FLNC) (NM_001458) Human Untagged Clone

CAT#: SC318734

FLNC (untagged)-Human filamin C, gamma (FLNC), transcript variant 1

  View "NM_001458" in other vectors (4)

USD 5,370.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Filamin C(FLNC) (NM_001458) Human Untagged Clone
Symbol FLNC
Synonyms ABP-280; ABP280A; ABPA; ABPL; FLN2; MFM5; MPD4
Vector pCMV6-Entry
Sequence Data
>NCBI ORF sequence for NM_001458, the custom clone sequence may differ by one or more nucleotides


ATGATGAACAACAGCGGCTACTCAGACGCCGGCCTCGGCCTGGGCGATGAGACAGACGAGATGCCGTCCA
CGGAGAAGGACCTGGCGGAGGACGCGCCGTGGAAGAAGATCCAGCAGAACACATTCACGCGCTGGTGCAA
TGAGCACCTCAAGTGCGTGGGCAAGCGCCTGACCGACCTGCAGCGCGACCTCAGCGACGGGCTCCGGCTC
ATCGCGCTGCTCGAGGTGCTCAGCCAGAAGCGCATGTACCGCAAGTTCCATCCGCGCCCCAACTTCCGCC
AAATGAAGCTGGAGAACGTGTCCGTGGCCCTCGAGTTCCTCGAGCGCGAGCACATCAAGCTCGTGTCCAT
AGACAGCAAGGCCATCGTGGATGGGAACCTGAAGCTGATCCTGGGCCTGATCTGGACGCTGATCCTGCAC
TACTCCATCTCCATGCCCATGTGGGAGGATGAAGATGATGAGGATGCCCGCAAACAGACGCCCAAGCAGC
GGCTGCTTGGCTGGATCCAGAACAAGGTGCCCCAGCTGCCCATCACCAACTTCAACCGTGACTGGCAGGA
CGGCAAAGCTCTGGGCGCCCTGGTGGACAACTGCGCCCCCGGTCTCTGCCCCGACTGGGAGGCCTGGGAC
CCCAACCAGCCCGTGGAGAACGCCCGGGAGGCCATGCAGCAGGCCGACGACTGGCTTGGGGTGCCCCAGG
TCATTGCCCCTGAGGAGATTGTGGACCCCAACGTGGATGAGCATTCTGTTATGACCTACCTGTCCCAGTT
CCCCAAGGCCAAGCTCAAACCTGGTGCCCCTGTTCGATCCAAGCAGCTGAACCCCAAGAAAGCCATCGCC
TATGGGCCTGGCATCGAGCCACAGGGCAACACCGTGCTGCAGCCTGCCCACTTCACCGTGCAGACGGTGG
ACGCGGGCGTGGGCGAGGTGCTGGTCTACATCGAGGACCCTGAAGGCCACACCGAGGAGGCTAAGGTGGT
TCCCAACAATGACAAGGATCGCACCTATGCTGTCTCCTATGTGCCCAAGGTCGCTGGGTTACACAAGGTG
ACCGTGCTCTTTGCTGGCCAGAACATTGAACGCAGTCCCTTTGAGGTGAACGTGGGCATGGCCCTGGGAG
ATGCCAACAAGGTGTCAGCCCGTGGCCCTGGCCTGGAACCTGTGGGCAATGTGGCCAACAAACCCACCTA
CTTTGACATCTACACTGCGGGGGCCGGCACTGGCGATGTTGCTGTGGTGATCGTGGACCCACAGGGCCGG
CGGGACACAGTGGAGGTGGCCCTGGAGGACAAGGGTGACAGCACGTTCCGCTGCACATACAGACCTGCCA
TGGAGGGGCCACATACCGTGCATGTGGCCTTTGCGGGTGCCCCCATCACCCGCAGTCCCTTCCCTGTCCA
TGTGTCGGAAGCCTGTAACCCCAACGCCTGCCGCGCCTCTGGGCGAGGCCTGCAGCCCAAGGGTGTTCGC
GTGAAAGAGGTGGCTGACTTCAAGGTGTTTACCAAGGGTGCCGGCAGCGGGGAGCTCAAGGTCACGGTCA
AGGGGCCAAAGGGCACAGAGGAGCCAGTGAAGGTGCGGGAGGCTGGGGATGGTGTGTTCGAGTGCGAGTA
CTACCCGGTGGTGCCTGGGAAGTATGTGGTGACCATCACGTGGGGCGGCTACGCCATCCCTCGCAGCCCC
TTTGAGGTACAGGTGAGCCCAGAGGCAGGAGTGCAAAAGGTCCGGGCCTGGGGTCCTGGTTTGGAGACTG
GCCAGGTGGGCAAGTCAGCCGATTTTGTGGTGGAAGCCATTGGCACCGAGGTGGGGACACTGGGCTTCTC
CATCGAGGGGCCCTCACAAGCCAAGATCGAATGTGACGACAAGGGGGATGGCTCCTGCGATGTGCGGTAC
TGGCCCACGGAGCCTGGGGAGTACGCTGTGCACGTCATCTGTGACGATGAGGACATCCGAGACTCACCCT
TCATTGCCCACATCCTGCCCGCCCCACCTGACTGCTTCCCAGATAAGGTGAAGGCCTTTGGGCCTGGCCT
GGAGCCTACCGGCTGCATCGTGGACAAGCCCGCTGAGTTCACCATTGATGCTCGTGCAGCTGGCAAGGGA
GACCTGAAGCTCTATGCCCAGGACGCCGACGGCTGTCCCATCGACATCAAGGTGATCCCCAACGGCGACG
GCACCTTCCGCTGCTCCTACGTGCCCACCAAGCCCATTAAGCACACCATCATCATCTCCTGGGGAGGCGT
AAACGTGCCCAAGAGCCCCTTCCGGGTGAACGTGGGCGAGGGCAGCCACCCCGAGCGGGTAAAGGTGTAC
GGCCCCGGAGTGGAGAAGACAGGCCTCAAGGCCAATGAGCCCACCTACTTCACGGTGGACTGCAGCGAGG
CGGGGCAAGGCGACGTGAGCATCGGCATCAAGTGCGCCCCAGGCGTGGTGGGCCCTGCAGAGGCTGACAT
TGACTTCGACATCATCAAGAATGACAACGACACCTTCACCGTCAAGTACACGCCACCAGGGGCGGGCCGC
TACACCATCATGGTGCTGTTTGCCAACCAGGAGATCCCCGCCAGCCCCTTCCACATCAAGGTGGACCCAT
CCCACGATGCCAGCAAAGTCAAGGCCGAGGGCCCTGGGCTGAATCGCACAGGTGTGGAAGTCGGGAAGCC
CACCCACTTCACGGTGCTGACCAAGGGAGCCGGCAAGGCCAAGCTGGATGTGCAGTTTGCAGGGACAGCC
AAGGGCGAGGTTGTGCGGGACTTTGAGATCATAGACAACCATGACTACTCCTACACTGTCAAGTACACCG
CTGTCCAGCAGGGCAACATGGCAGTGACAGTGACTTATGGCGGGGACCCTGTCCCCAAGAGCCCCTTTGT
GGTGAATGTGGCACCCCCGCTGGACCTCAGCAAAATCAAAGTTCAGGGCCTTAATAGCAAGGTGGCTGTG
GGACAGGAACAAGCATTCTCTGTGAACACACGAGGGGCTGGCGGTCAGGGCCAACTGGATGTGCGGATGA
CTTCGCCCTCTCGCCGGCCCATCCCCTGCAAGCTGGAGCCAGGCGGTGGAGCGGAAGCCCAGGCTGTGCG
CTACATGCCCCCGGAGGAGGGGCCCTACAAGGTGGATATCACCTACGATGGTCACCCGGTGCCTGGCAGC
CCGTTTGCTGTGGAGGGTGTCCTGCCCCCTGATCCCTCCAAGGTCTGTGCTTATGGCCCGGGTCTCAAGG
GTGGACTGGTAGGCACCCCCGCGCCATTCTCCATCGACACCAAGGGGGCTGGCACAGGTGGCCTGGGGCT
GACCGTAGAGGGCCCCTGCGAGGCCAAGATCGAGTGCCAGGACAATGGTGATGGCTCATGTGCTGTCAGC
TACCTGCCCACGGAGCCTGGCGAGTACACCATCAACATCCTGTTTGCTGAGGCCCACATCCCTGGCTCGC
CCTTCAAAGCCACCATTCGGCCTGTGTTTGACCCGAGCAAGGTGCGGGCCAGTGGACCGGGCCTGGAGCG
CGGCAAGGTCGGTGAGGCAGCCACCTTCACTGTGGACTGCTCAGAGGCAGGCGAGGCGGAGCTGACCATT
GAGATCCTGTCGGATGCCGGGGTCAAGGCCGAGGTGCTGATCCACAACAACGCGGATGGCACCTACCACA
TCACCTACAGCCCTGCCTTCCCTGGCACCTACACCATTACCATCAAGTATGGCGGGCATCCCGTGCCCAA
ATTCCCCACCCGTGTCCATGTGCAGCCTGCGGTCGATACCAGTGGCGTCAAGGTCTCAGGGCCTGGTGTT
GAGCCACACGGTGTCCTGCGGGAGGTGACCACTGAGTTCACTGTGGATGCAAGATCCCTAACAGCCACAG
GCGGCAACCACGTGACGGCTCGTGTGCTCAACCCCTCGGGGGCCAAGACAGACACCTATGTGACAGACAA
TGGGGACGGCACCTACCGAGTGCAGTACACCGCCTACGAGGAGGGCGTGCATCTGGTGGAGGTCCTGTAT
GATGAGGTCGCTGTGCCCAAGAGCCCCTTCCGAGTGGGCGTGACCGAGGGCTGTGATCCCACCCGCGTCC
GAGCCTTCGGGCCAGGCCTGGAGGGTGGCTTGGTCAACAAGGCCAACCGATTCACTGTGGAGACCAGGGG
AGCGGGCACCGGGGGCCTTGGCCTAGCCATCGAGGGTCCCTCGGAAGCCAAGATGTCCTGCAAGGACAAC
AAGGATGGTAGCTGCACCGTGGAGTACATCCCCTTCACTCCTGGAGACTATGACGTCAACATCACCTTCG
GGGGGCGGCCCATCCCAGGGAGCCCGTTCCGCGTGCCAGTGAAGGATGTGGTGGACCCTGGGAAGGTGAA
GTGCTCAGGGCCAGGGCTGGGGGCTGGTGTCAGGGCCCGGGTTCCTCAGACCTTCACAGTGGACTGCAGT
CAAGCTGGCCGGGCGCCCCTGCAGGTGGCTGTGCTGGGCCCCACAGGTGTGGCCGAGCCTGTGGAGGTGC
GGGACAATGGAGATGGCACCCACACTGTCCACTACACCCCAGCCACTGACGGGCCCTACACGGTAGCCGT
CAAGTATGCTGACCAGGAGGTGCCACGCAGCCCCTTCAAGATCAAGGTCCTCCCAGCTCATGATGCCAGC
AAGGTGCGGGCCAGCGGCCCAGGCCTCAACGCCTCTGGCATCCCTGCCAGCCTGCCTGTGGAGTTCACCA
TCGACGCACGGGACGCGGGCGAGGGGTTGCTCACTGTCCAGATCTTGGACCCCGAGGGTAAGCCCAAGAA
GGCCAACATCCGGGACAATGGGGATGGCACGTACACTGTGTCCTACCTGCCGGACATGAGTGGCCGGTAC
ACCATCACCATCAAGTATGGCGGTGATGAGATCCCCTACTCGCCCTTCCGCATCCATGCTCTGCCCACTG
GGGATGCCAGCAAGTGCCTCGTCACAGTGTCCATTGGAGGCCATGGCCTGGGTGCCTGCCTGGGCCCTCG
AATCCAGATTGGGCAGGAGACGGTGATCACGGTGGATGCCAAGGCAGCCGGTGAGGGGAAGGTGACATGC
ACGGTGTCCACGCCGGATGGGGCAGAGCTCGATGTGGATGTGGTTGAGAACCATGACGGTACCTTTGACA
TCTACTACACAGCGCCCGAGCCGGGCAAGTACGTCATCACCATCCGCTTCGGGGGTGAGCACATCCCCAA
CAGCCCCTTCCACGTGCTGGCGTGTGACCCCCTGCCGCACGAGGAGGAGCCCTCTGAAGTGCCACAGCTG
CGCCAGCCCTACGCTCCTCCCCGGCCCGGCGCCCGCCCCACACACTGGGCCACAGAGGAGCCAGTGGTGC
CTGTGGAGCCAATGGAGTCCATGCTGAGGCCCTTCAACCTGGTCATCCCCTTCGCGGTGCAGAAAGGGGA
GCTCACAGGAGAGGTGCGGATGCCCTCGGGGAAGACGGCACGGCCCAACATCACCGACAACAAGGACGGC
ACCATCACGGTGAGGTATGCACCCACTGAGAAAGGCCTGCACCAGATGGGGATCAAGTATGACGGCAACC
ACATCCCTGGGAGCCCCTTACAGTTCTATGTGGATGCCATCAACAGCCGCCATGTCAGTGCCTATGGGCC
AGGCCTGAGCCATGGCATGGTCAACAAGCCAGCCACCTTCACTATTGTCACCAAAGATGCTGGAGAAGGG
GGTCTGTCACTGGCCGTGGAGGGCCCATCCAAGGCAGAGATCACCTGTAAGGACAACAAGGATGGCACCT
GCACCGTGTCCTATCTGCCGACTGCGCCTGGAGACTACAGCATCATCGTGCGCTTCGATGACAAGCACAT
CCCGGGGAGCCCCTTCACAGCCAAGATCACAGGTGATGACTCCATGAGGACCTCACAGCTGAATGTGGGC
ACCTCCACGGACGTGTCACTGAAGATCACCGAGAGTGATCTGAGCCAGCTGACCGCCAGCATCCGTGCCC
CCTCGGGCAACGAGGAGCCCTGCCTGCTGAAGCGCCTGCCCAACCGGCACATTGGGATCTCCTTCACCCC
CAAGGAGGTCGGGGAGCACGTGGTGAGCGTGCGCAAGAGTGGCAAGCATGTCACCAACAGCCCCTTCAAG
ATCCTGGTGGGGCCATCTGAGATCGGGGACGCCAGCAAGGTGCGGGTCTGGGGCAAGGGGCTTTCCGAGG
GACACACATTCCAGGTGGCAGAGTTCATCGTGGACACTCGCAATGCAGGTTATGGGGGCTTGGGGCTGAG
TATTGAAGGCCCAAGCAAGGTGGACATCAACTGTGAGGACATGGAGGACGGGACATGCAAAGTCACCTAC
TGCCCCACCGAGCCCGGCACCTACATCATCAACATCAAGTTTGCTGACAAGCACGTGCCTGGAAGCCCCT
TCACTGTGAAGGTGACCGGCGAGGGCCGCATGAAGGAGAGCATCACCCGGCGGAGACAGGCACCTTCCAT
CGCCACCATCGGCAGCACCTGTGACCTCAACCTCAAGATCCCAGGAAACTGGTTCCAGATGGTGTCTGCC
CAGGAGCGCCTGACACGCACCTTCACACGCAGCAGCCACACCTACACCCGCACGGAGCGCACGGAGATCA
GCAAGACGCGGGGCGGGGAGACAAAGCGCGAGGTGCGGGTGGAGGAGTCCACCCAGGTCGGCGGGGACCC
CTTCCCTGCTGTGTTTGGGGACTTCCTGGGCCGGGAGCGCCTGGGATCCTTCGGCAGCATCACCCGGCAG
CAGGAGGGTGAGGCCAGCTCTCAGGACATGACTGCACAGGTGACCAGCCCATCGGGCAAGGTGGAAGCCG
CAGAGATCGTCGAGGGCGAGGACAGCGCCTACAGCGTGCGCTTTGTGCCCCAGGAAATGGGGCCCCATAC
GGTCGCTGTCAAGTACCGTGGCCAGCACGTGCCCGGCAGCCCCTTTCAGTTCACTGTGGGGCCGCTGGGT
GAAGGTGGTGCCCACAAGGTGCGGGCCGGAGGCACAGGGCTGGAGCGAGGTGTGGCCGGCGTGCCAGCCG
AGTTCAGCATCTGGACCCGGGAGGCTGGCGCTGGGGGCCTGTCCATTGCTGTGGAGGGTCCTAGCAAAGC
GGAGATTGCATTTGAGGATCGCAAAGATGGCTCCTGCGGCGTCTCCTATGTCGTCCAGGAACCAGGTGAC
TATGAGGTCTCCATCAAGTTCAATGATGAGCACATCCCAGACAGCCCCTTTGTGGTGCCTGTGGCCTCCC
TCTCGGATGACGCTCGCCGTCTCACTGTCACCAGCCTCCAGGAGACGGGGCTCAAGGTGAACCAGCCAGC
GTCCTTTGCCGTGCAGCTGAACGGTGCCCGGGGCGTGATTGATGCCCGGGTGCACACACCCTCGGGGGCT
GTGGAGGAGTGCTACGTCTCTGAGCTGGACAGTGACAAGCACACCATCCGCTTCATCCCCCACGAGAATG
GCGTCCACTCCATCGATGTCAAGTTCAACGGTGCCCACATCCCTGGAAGTCCCTTCAAGATCCGCGTTGG
GGAGCAGAGCCAGGCTGGGGACCCAGGCTTGGTGTCAGCCTACGGTCCTGGGCTCGAGGGAGGCACTACC
GGTGTGTCATCAGAGTTCATCGTGAACACCCTGAATGCCGGCTCGGGGGCCTTGTCTGTCACCATTGATG
GCCCCTCCAAGGTGCAGCTGGACTGTCGGGAGTGTCCTGAGGGCCATGTGGTCACTTATACTCCCATGGC
CCCTGGCAACTACCTCATTGCCATCAAGTACGGTGGCCCCCAGCACATCGTGGGCAGCCCCTTCAAGGCC
AAGGTCACTGGTCCGAGGCTGTCCGGAGGCCACAGCCTTCACGAAACATCCACGGTTCTGGTGGAGACTG
TGACCAAGTCCTCCTCAAGCCGGGGCTCCAGCTACAGCTCCATCCCCAAGTTCTCCTCAGATGCCAGCAA
GGTGGTGACTCGGGGCCCTGGGCTGTCCCAGGCCTTCGTGGGCCAGAAGAACTCCTTCACCGTGGACTGC
AGCAAAGCAGGCACCAACATGATGATGGTGGGCGTGCACGGCCCCAAGACCCCCTGTGAGGAGGTGTACG
TGAAGCACATGGGGAACCGGGTGTACAATGTCACCTACACTGTCAAGGAGAAAGGGGACTACATCCTCAT
TGTCAAGTGGGGTGACGAAAGTGTCCCTGGAAGCCCCTTCAAAGTCAAGGTCCCTTGA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001458
ORF Size 8178 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001458.4, NP_001449
RefSeq Size 9149
RefSeq ORF 8178
Locus ID 2318
Cytogenetics 7q32.1
Protein Pathways MAPK signaling pathway, Focal adhesion
Gene Summary This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

Other Versions

Other products for "FLNC"
Frequently bought together (2)
Rabbit Polyclonal Anti-FLNC Antibody
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones