JAK1 (NM_002227) Human Untagged Clone

USD 1,070.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name JAK1 (NM_002227) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol JAK1
Synonyms JAK1A; JAK1B; JTK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_002227, the custom clone sequence may differ by one or more nucleotides


ATGCAGTATCTAAATATAAAAGAGGACTGCAATGCCATGGCTTTCTGTGCTAAAATGAGGAGCTCCAAGA
AGACTGAGGTGAACCTGGAGGCCCCTGAGCCAGGGGTGGAAGTGATCTTCTATCTGTCGGACAGGGAGCC
CCTCCGGCTGGGCAGTGGAGAGTACACAGCAGAGGAACTGTGCATCAGGGCTGCACAGGCATGCCGTATC
TCTCCTCTTTGTCACAACCTCTTTGCCCTGTATGACGAGAACACCAAGCTCTGGTATGCTCCAAATCGCA
CCATCACCGTTGATGACAAGATGTCCCTCCGGCTCCACTACCGGATGAGGTTCTATTTCACCAATTGGCA
TGGAACCAACGACAATGAGCAGTCAGTGTGGCGTCATTCTCCAAAGAAGCAGAAAAATGGCTACGAGAAA
AAAAAGATTCCAGATGCAACCCCTCTCCTTGATGCCAGCTCACTGGAGTATCTGTTTGCTCAGGGACAGT
ATGATTTGGTGAAATGCCTGGCTCCTATTCGAGACCCCAAGACCGAGCAGGATGGACATGATATTGAGAA
CGAGTGTCTAGGGATGGCTGTCCTGGCCATCTCACACTATGCCATGATGAAGAAGATGCAGTTGCCAGAA
CTGCCCAAGGACATCAGCTACAAGCGATATATTCCAGAAACATTGAATAAGTCCATCAGACAGAGGAACC
TTCTCACCAGGATGCGGATAAATAATGTTTTCAAGGATTTCCTAAAGGAATTTAACAACAAGACCATTTG
TGACAGCAGCGTGTCCACGCATGACCTGAAGGTGAAATACTTGGCTACCTTGGAAACTTTGACAAAACAT
TACGGTGCTGAAATATTTGAGACTTCCATGTTACTGATTTCATCAGAAAATGAGATGAATTGGTTTCATT
CGAATGACGGTGGAAACGTTCTCTACTACGAAGTGATGGTGACTGGGAATCTTGGAATCCAGTGGAGGCA
TAAACCAAATGTTGTTTCTGTTGAAAAGGAAAAAAATAAACTGAAGCGGAAAAAACTGGAAAATAAACAC
AAGAAGGATGAGGAGAAAAACAAGATCCGGGAAGAGTGGAACAATTTTTCTTACTTCCCTGAAATCACTC
ACATTGTAATAAAGGAGTCTGTGGTCAGCATTAACAAGCAGGACAACAAGAAAATGGAACTGAAGCTCTC
TTCCCACGAGGAGGCCTTGTCCTTTGTGTCCCTGGTAGATGGCTACTTCCGGCTCACAGCAGATGCCCAT
CATTACCTCTGCACCGACGTGGCCCCCCCGTTGATCGTCCACAACATACAGAATGGCTGTCATGGTCCAA
TCTGTACAGAATACGCCATCAATAAATTGCGGCAAGAAGGAAGCGAGGAGGGGATGTACGTGCTGAGGTG
GAGCTGCACCGACTTTGACAACATCCTCATGACCGTCACCTGCTTTGAGAAGTCTGAGCAGGTGCAGGGT
GCCCAGAAGCAGTTCAAGAACTTTCAGATCGAGGTGCAGAAGGGCCGCTACAGTCTGCACGGTTCGGACC
GCAGCTTCCCCAGCTTGGGAGACCTCATGAGCCACCTCAAGAAGCAGATCCTGCGCACGGATAACATCAG
CTTCATGCTAAAACGCTGCTGCCAGCCCAAGCCCCGAGAAATCTCCAACCTGCTGGTGGCTACTAAGAAA
GCCCAGGAGTGGCAGCCCGTCTACCCCATGAGCCAGCTGAGTTTCGATCGGATCCTCAAGAAGGATCTGG
TGCAGGGCGAGCACCTTGGGAGAGGCACGAGAACACACATCTATTCTGGGACCCTGATGGATTACAAGGA
TGACGAAGGAACTTCTGAAGAGAAGAAGATAAAAGTGATCCTCAAAGTCTTAGACCCCAGCCACAGGGAT
ATTTCCCTGGCCTTCTTCGAGGCAGCCAGCATGATGAGACAGGTCTCCCACAAACACATCGTGTACCTCT
ATGGCGTCTGTGTCCGCGACGTGGAGAATATCATGGTGGAAGAGTTTGTGGAAGGGGGTCCTCTGGATCT
CTTCATGCACCGGAAAAGCGATGTCCTTACCACACCATGGAAATTCAAAGTTGCCAAACAGCTGGCCAGT
GCCCTGAGCTACTTGGAGGATAAAGACCTGGTCCATGGAAATGTGTGTACTAAAAACCTCCTCCTGGCCC
GTGAGGGCATCGACAGTGAGTGTGGCCCATTCATCAAGCTCAGTGACCCCGGCATCCCCATTACGGTGCT
GTCTAGGCAAGAATGCATTGAACGAATCCCATGGATTGCTCCTGAGTGTGTTGAGGACTCCAAGAACCTG
AGTGTGGCTGCTGACAAGTGGAGCTTTGGAACCACGCTCTGGGAAATCTGCTACAATGGCGAGATCCCCT
TGAAAGACAAGACGCTGATTGAGAAAGAGAGATTCTATGAAAGCCGGTGCAGGCCAGTGACACCATCATG
TAAGGAGCTGGCTGACCTCATGACCCGCTGCATGAACTATGACCCCAATCAGAGGCCTTTCTTCCGAGCC
ATCATGAGAGACATTAATAAGCTTGAAGAGCAGAATCCAGATATTGTTTCAGAAAAAAAACCAGCAACTG
AAGTGGACCCCACACATTTTGAAAAGCGCTTCCTAAAGAGGATCCGTGACTTGGGAGAGGGCCACTTTGG
GAAGGTTGAGCTCTGCAGGTATGACCCCGAAGGGGACAATACAGGGGAGCAGGTGGCTGTTAAATCTCTG
AAGCCTGAGAGTGGAGGTAACCACATAGCTGATCTGAAAAAGGAAATCGAGATCTTAAGGAACCTCTATC
ATGAGAACATTGTGAAGTACAAAGGAATCTGCACAGAAGACGGAGGAAATGGTATTAAGCTCATCATGGA
ATTTCTGCCTTCGGGAAGCCTTAAGGAATATCTTCCAAAGAATAAGAACAAAATAAACCTCAAACAGCAG
CTAAAATATGCCGTTCAGATTTGTAAGGGGATGGACTATTTGGGTTCTCGGCAATACGTTCACCGGGACT
TGGCAGCAAGAAATGTCCTTGTTGAGAGTGAACACCAAGTGAAAATTGGAGACTTCGGTTTAACCAAAGC
AATTGAAACCGATAAGGAGTATTACACCGTCAAGGATGACCGGGACAGCCCTGTGTTTTGGTATGCTCCA
GAATGTTTAATGCAATCTAAATTTTATATTGCCTCTGACGTCTGGTCTTTTGGAGTCACTCTGCATGAGC
TGCTGACTTACTGTGATTCAGATTCTAGTCCCATGGCTTTGTTCCTGAAAATGATAGGCCCAACCCATGG
CCAGATGACAGTCACAAGACTTGTGAATACGTTAAAAGAAGGAAAACGCCTGCCGTGCCCACCTAACTGT
CCAGATGAGGTTTATCAACTTATGAGGAAATGCTGGGAATTCCAACCATCCAATCGGACAAGCTTTCAGA
ACCTTATTGAAGGATTTGAAGCACTTTTAAAATAA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Tag Tag Free
ACCN NM_002227
ORF Size 3465 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002227.2, NP_002218
RefSeq Size 5053
RefSeq ORF 3465
Locus ID 3716
Cytogenetics 1p31.3
Domains pkinase, SH2
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Jak-STAT signaling pathway, Pancreatic cancer, Pathways in cancer
Gene Summary This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Citations (1)

Other Versions

Other products for "JAK1"
Frequently bought together (2)
Rabbit polyclonal JAK1 (Ab-1022) antibody
    • 100 ul

USD 335.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones