GARS1 (NM_002047) Human Untagged Clone

CAT#: SC318220

Reviews ()
Write a review

GARS (untagged)-Human glycyl-tRNA synthetase (GARS)



  "NM_002047" in other vectors (7)

Reconstitution Protocol

USD 745.00

3 Weeks*

Size
    • 10 ug

Product images

Other products for "GARS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GARS1
Synonyms CMT2D; DSMAV; GARS; GlyRS; HMN5; HMN5A; SMAD1; SMAJI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318220 representing NM_002047.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCTCTCCGCGTCCAGTGCTGCTTAGAGGTGCTCGCGCCGCTCTGCTGCTGCTGCTGCCGCCCCGG
CTCTTAGCCCGACCCTCGCTCCTGCTCCGCCGGTCCCTCAGCGCGGCCTCCTGCCCCCCGATCTCCTTG
CCCGCCGCCGCCTCCCGGAGCAGCATGGACGGCGCGGGGGCTGAGGAGGTGCTGGCACCTCTGAGGCTA
GCAGTGCGCCAGCAGGGAGATCTTGTGCGAAAACTCAAAGAAGATAAAGCACCCCAAGTAGACGTAGAC
AAAGCAGTGGCTGAGCTCAAAGCCCGCAAGAGGGTTCTGGAAGCAAAGGAGCTGGCGTTACAGCCCAAA
GATGATATTGTAGACCGAGCAAAAATGGAAGATACCCTGAAGAGGAGGTTTTTCTATGATCAAGCTTTT
GCTATTTATGGAGGTGTTAGTGGTCTGTATGACTTTGGGCCAGTTGGCTGTGCTTTGAAGAACAATATT
ATTCAGACCTGGAGGCAGCACTTTATCCAAGAGGAACAGATCCTGGAGATCGATTGCACCATGCTCACC
CCTGAGCCAGTTTTAAAGACCTCTGGCCATGTAGACAAATTTGCTGACTTCATGGTGAAAGACGTAAAA
AATGGAGAATGTTTTCGTGCTGACCATCTATTAAAAGCTCATTTACAGAAATTGATGTCTGATAAGAAG
TGTTCTGTCGAAAAGAAATCAGAAATGGAAAGTGTTTTGGCCCAGCTTGATAACTATGGACAGCAAGAA
CTTGCGGATCTTTTTGTGAACTATAATGTAAAATCTCCCATTACTGGAAATGATCTATCCCCTCCAGTG
TCTTTTAACTTAATGTTCAAGACTTTCATTGGGCCTGGAGGAAACATGCCTGGGTACTTGAGACCAGAA
ACTGCACAGGGGATTTTCTTGAATTTCAAACGACTTTTGGAGTTCAACCAAGGAAAGTTGCCTTTTGCT
GCTGCCCAGATTGGAAATTCTTTTAGAAATGAGATCTCCCCTCGATCTGGACTGATCAGAGTCAGAGAA
TTCACAATGGCAGAAATTGAGCACTTTGTAGATCCCAGTGAGAAAGACCACCCCAAGTTCCAGAATGTG
GCAGACCTTCACCTTTATTTGTATTCAGCAAAAGCCCAGGTCAGCGGACAGTCCGCTCGGAAAATGCGC
CTGGGAGATGCTGTTGAACAGGGTGTGATTAATAACACAGTATTAGGCTATTTCATTGGCCGCATCTAC
CTCTACCTCACGAAGGTTGGAATATCTCCAGATAAACTCCGCTTCCGGCAGCACATGGAGAATGAGATG
GCCCATTATGCCTGTGACTGTTGGGATGCAGAATCCAAAACATCCTACGGTTGGATTGAGATTGTTGGA
TGTGCTGATCGTTCCTGTTATGACCTCTCCTGTCATGCACGAGCCACCAAAGTCCCACTTGTAGCTGAG
AAACCTCTGAAAGAACCCAAAACAGTCAATGTTGTTCAGTTTGAACCCAGTAAGGGAGCAATTGGTAAG
GCATATAAGAAGGATGCAAAACTGGTGATGGAGTATCTTGCCATTTGTGATGAGTGCTACATTACAGAA
ATGGAGATGCTGCTGAATGAGAAAGGGGAATTCACAATTGAAACTGAAGGGAAAACATTTCAGTTAACA
AAAGACATGATCAATGTGAAGAGATTCCAGAAAACACTATATGTGGAAGAAGTTGTTCCGAATGTAATT
GAACCTTCCTTCGGCCTGGGTAGGATCATGTATACGGTATTTGAACATACATTCCATGTACGAGAAGGA
GATGAACAGAGAACATTCTTCAGTTTCCCTGCTGTAGTTGCTCCATTCAAATGTTCCGTCCTCCCACTG
AGCCAAAACCAGGAGTTCATGCCATTTGTCAAGGAATTATCGGAAGCCCTGACCAGGCATGGAGTATCT
CACAAAGTAGACGATTCCTCTGGGTCAATCGGAAGGCGCTATGCCAGGACTGATGAGATTGGCGTGGCT
TTTGGTGTCACCATTGACTTTGACACAGTGAACAAGACCCCCCACACTGCAACTCTGAGGGACCGTGAC
TCAATGCGGCAGATAAGAGCAGAGATCTCTGAGCTGCCCAGCATAGTCCAAGACCTAGCCAATGGCAAC
ATCACATGGGCTGATGTGGAGGCCAGGTATCCTCTGTTTGAAGGGCAAGAGACTGGTAAAAAAGAGACA
ATCGAGGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_002047
Insert Size 2220 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002047.3
RefSeq Size 2432 bp
RefSeq ORF 2220 bp
Locus ID 2617
UniProt ID P41250
Cytogenetics 7p14.3
Domains WHEP-TRS, tRNA-synt_2b, HGTP_anticodon
Protein Pathways Aminoacyl-tRNA biosynthesis
MW 83.2 kDa
Gene Summary This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.