LXR beta (NR1H2) (NM_007121) Human Untagged Clone

CAT#: SC317757

NR1H2 (untagged)-Human nuclear receptor subfamily 1, group H, member 2 (NR1H2)


  "NM_007121" in other vectors (7)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LXR beta"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LXR beta
Synonyms LXR-b; LXRB; NER; NER-I; RIP15; UNR
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_007121.3 CGGGGTTGCCGGAAGAAGTGGCGAAGTTACTTTTGAGGGTATTTGAGTAGCGGCGGTGTG
TCAGGGGCTAAAGAGGAGGACGAAGAAAAGCAGAGCAAGGGAACCCAGGGCAACAGGAGT
AGTTCACTCCGCGAGAGGCCGTCCACGAGACCCCCGCGCGCAGCCATGAGCCCCGCCCCC
CGCTGTTGCTTGGAGAGGGGCGGGACCTGGAGAGAGGCTGCTCCGTGACCCCACCATGTC
CTCTCCTACCACGAGTTCCCTGGATACCCCCCTGCCTGGAAATGGCCCCCCTCAGCCTGG
CGCCCCTTCTTCTTCACCCACTGTAAAGGAGGAGGGTCCGGAGCCGTGGCCCGGGGGTCC
GGACCCTGATGTCCCAGGCACTGATGAGGCCAGCTCAGCCTGCAGCACAGACTGGGTCAT
CCCAGATCCCGAAGAGGAACCAGAGCGCAAGCGAAAGAAGGGCCCAGCCCCGAAGATGCT
GGGCCACGAGCTTTGCCGTGTCTGTGGGGACAAGGCCTCCGGCTTCCACTACAACGTGCT
CAGCTGCGAAGGCTGCAAGGGCTTCTTCCGGCGCAGTGTGGTCCGTGGTGGGGCCAGGCG
CTATGCCTGCCGGGGTGGCGGAACCTGCCAGATGGACGCTTTCATGCGGCGCAAGTGCCA
GCAGTGCCGGCTGCGCAAGTGCAAGGAGGCAGGGATGAGGGAGCAGTGCGTCCTTTCTGA
AGAACAGATCCGGAAGAAGAAGATTCGGAAACAACAGCAGCAGGAGTCACAGTCACAGTC
GCAGTCACCTGTGGGGCCGCAGGGCAGCAGCAGCTCAGCCTCTGGGCCTGGGGCTTCCCC
TGGTGGATCTGAGGCAGGCAGCCAGGGCTCCGGGGAAGGCGAGGGTGTCCAGCTAACAGC
GGCTCAAGAACTAATGATCCAGCAGTTGGTGGCGGCCCAACTGCAGTGCAACAAACGCTC
CTTCTCCGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGCGCAGACCCCCAGTCCCGAGA
TGCCCGCCAGCAACGCTTTGCCCACTTCACGGAGCTGGCCATCATCTCAGTCCAGGAGAT
CGTGGACTTCGCTAAGCAAGTGCCTGGTTTCCTGCAGCTGGGCCGGGAGGACCAGATCGC
CCTCCTGAAGGCATCCACTATCGAGATCATGCTGCTAGAGACAGCCAGGCGCTACAACCA
CGAGACAGAGTGTATCACCTTCTTGAAGGACTTCACCTACAGCAAGGACGACTTCCACCG
TGCAGGCCTGCAGGTGGAGTTCATCAACCCCATCTTCGAGTTCTCGCGGGCCATGCGGCG
GCTGGGCCTGGACGACGCTGAGTACGCCCTGCTCATCGCCATCAACATCTTCTCGGCCGA
CCGGCCCAACGTGCAGGAGCCGGGCCGCGTGGAGGCGTTGCAGCAGCCCTACGTGGAGGC
GCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTGCGCTTCCCGCGCATGCT
CATGAAGCTGGTGAGCCTGCGCACGCTGAGCTCTGTGCACTCGGAGCAGGTCTTCGCCTT
GCGGCTCCAGGACAAGAAGCTGCCGCCTCTGCTGTCGGAGATCTGGGACGTCCACGAGTG
AGGGGCTGGCCACCCAGCCCCACAGCCTTGCCTGACCACCCTCCAGCAGATAGACGCCGG
CACCCCTTCCTCTTCCTAGGGTGGAAGGGGCCCTGGGCCGAGCCTGTAGACCTATCGGCT
CTCATCCCTTGGGATAAGCCCCAGTCCAGGTCCAGGAGGCTCCCTCCCTGCCCAGCGAGT
CTTCCAGAAGGGGTGAAAGGGTTGCAGGTCCCGACCACTGACCCTTCCCGGCTGCCCTCC
CTCCCCAGCTTACACCTCAAGCCCAGCACGCAGTGCACCTTGAACAGAGGGAGGGGAGGA
CCCATGGCTCTCCCCCCTAGCCCGGGAGACCAGGGGCCTTCCTCTTCCTCTGCTTTTATT
TAATAAAAACTAAAAACAGAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_007121
Insert Size 2093 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007121.4, NP_009052.3
RefSeq Size 2093 bp
RefSeq ORF 1386 bp
Locus ID 7376
UniProt ID P55055
Cytogenetics 19q13.33
Domains HOLI, zf-C4
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Gene Summary The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). CCDS Note: The coding region was updated to make it identical to the current human reference genome sequence.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.