Bestrophin 3 (BEST3) (NM_152439) Human Untagged Clone

SKU
SC317745
BEST3 (untagged)-Human bestrophin 3 (BEST3), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Bestrophin 3
Synonyms VMD2L3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317745 representing NM_152439.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAACAGATGAAAGGAAATTATTCAACCACCTCAAGTCTCCTCATCTGAAATATTGGGTTCCATTC
ATCTGGTTTGGAAATCTTGCAACTAAAGCCCGGAATGAAGGTAGAATCAGAGACAGTGTTGATCTGCAA
TCATTGATGACTGAAATGAATCGATACCGCTCTTGGTGCAGCCTCTTATTCGGTTATGACTGGGTTGGG
ATTCCGCTGGTTTACACCCAGGTAGCAGAGCAGCTTATCAACCCTTTTGGAGAAGATGATGATGATTTT
GAAACTAACTGGTGCATTGACAGAAATTTGCAGGTCTCTCTTTTAGCTGTGGACGAAATGCACATGAGC
TTACCCAAGATGAAGAAGGACATTTACTGGGACGATTCTGCTGCTCGCCCACCATACACATTGGCAGCT
GCTGACTACTGCATACCCTCATTTCTGGGGTCAACAGTCCAGATGGGGCTGTCTGGGTCCGACTTTCCT
GACGAGGAGTGGCTGTGGGATTATGAGAAGCATGGCCATCGGCATTCCATGATAAGAAGAGTCAAGCGG
TTCCTGAGTGCCCACGAACACCCCTCCAGCCCCAGAAGAAGAAGCTACAGGAGGCAGACAAGTGACAGC
TCCATGTTCTTACCCCGAGATGACCTCAGCCCAGCCAGGGACCTACTGGATGTGCCCTCAAGAAACCCC
CCCAGGGCCTCACCCACCTGGAAGAAATCCTGCTTCCCAGAAGGAAGCCCCACGCTGCACTTCAGCATG
GGAGAGCTGTCCACCATCAGGGAGACCAGCCAGACAAGCACTTTACAGAGCCTGACCCCACAGTCCAGT
GTGAGAACTTCCCCCATCAAAATGCCACTGGTACCTGAGGTATTGATCACAGCAGCCGAAGCACCAGTG
CCCACATCAGGGGGCTACCACCATGATTCCGCTACCTCCATCTTGAGCTCTGAGTTTACAGGGGTTCAG
CCAAGCAAGACTGAGCAGCAGCAGGGCCCCATGGGATCCATCCTGTCTCCCTCAGAGAAGGAGACACCT
CCTGGAGGCCCCAGTCCCCAGACAGTTTCAGCCAGCGCTGAGGAAAATATATTCAACTGTGAAGAAGAC
CCTGGTGATACCTTTCTAAAAAGGTGGAGTCTTCCGGGATTCCTGGGGTCCAGCCACACTTCCCTGGGA
AACCTAAGTCCAGACCCCATGAGCTCTCAGCCAGCTCTTTTAATTGACACAGAAACATCCTCAGAGATC
AGTGGGATCAACATTGTGGCTGGCTCTCGAGTCTCTTCTGATATGCTGTATTTAATGGAAAACCTGGAC
ACCAAGGAAACAGATATCATAGAGCTGAACAAGGAAACTGAGGAATCACCCAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_152439
Insert Size 1368 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152439.3
RefSeq Size 2901 bp
RefSeq ORF 1368 bp
Locus ID 144453
UniProt ID Q8N1M1
Cytogenetics 12q15
Protein Families Ion Channels: Other, Transmembrane
MW 51 kDa
Summary BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, uses a downstream in-frame start codon, and lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:Bestrophin 3 (BEST3) (NM_152439) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218436 BEST3 (Myc-DDK-tagged)-Human bestrophin 3 (BEST3), transcript variant 2 10 ug
$457.00
RC218436L3 Lenti ORF clone of Human bestrophin 3 (BEST3), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC218436L4 Lenti ORF clone of Human bestrophin 3 (BEST3), transcript variant 2, mGFP tagged 10 ug
$757.00
RG218436 BEST3 (tGFP-tagged) - Human bestrophin 3 (BEST3), transcript variant 2 10 ug
$657.00
SC100666 BEST3 (untagged)-Human bestrophin 3 (BEST3), transcript variant 2 10 ug
$885.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.