MARCHF11 (NM_001102562) Human Untagged Clone

CAT#: SC316932

41344 (untagged)-Human membrane-associated ring finger (C3HC4) 11 (MARCH11)


  "NM_001102562" in other vectors (6)

Reconstitution Protocol

USD 732.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
MARCH11 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MARCHF11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MARCHF11
Synonyms MARCH-XI; MARCH11; RNF226
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316932 representing NM_001102562.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTTTGAGGGCGGCCACGGCGGCAGTCGGTGTCGCGGGGCGGAGAGCGGGGACGCCGAGCCTCCC
CCGCAACCTCCCCCGCCGCCGCCGCCGACGCCGCCGCCGGGAGAGCCGGCCCCGGTCCCCGCGGCCCCG
CGCTACCTGCCGCCGCTGCCCGCGTCCCCCGAGACCCCCGAGCGCGCCGCGGGGCCAAGCGAGCCGCTA
GGGGAGGTGGCCCCGCGGTGCAGGGGAGCGGACGAGCTGCCGCCTCCGCCCCTGCCCCTGCAGCCCGCC
GGCCAGGAAGTGGCGGCGGCCGGCGACTCCGGGGAAGGTCCGAGGCGCCTCCCGGAGGCGGCAGCAGCG
AAAGGCGGCCCCGGGGAGTCTGAGGCCGGCGCGGGCGGCGAGCGCGAGCGGCGGGGCGCCGGAGACCAG
CCCGAGACGCGCTCGGTGTGCAGCAGCCGCAGCAGCAGCAGTGGCGGCGGCGACCAGCGCGCTGGGCAC
CAGCACCAGCACCACCAGCCCATCTGCAAGATCTGCTTCCAGGGCGCGGAGCAGGGTGAGTTGTTGAAC
CCCTGCCGATGTGATGGGTCAGTTCGGTATACACATCAGCTGTGCCTGCTAAAATGGATCAGTGAGAGA
GGTTCCTGGACCTGTGAACTTTGCTGTTATAGATACCATGTTATAGCCATTAAAATGAAACAACCTTGC
CAGTGGCAGAGCATTTCTATAACACTGGTTGAGAAAGTTCAGATGATTGCTGTAATCCTAGGATCCCTG
TTCTTAATAGCCAGTGTGACTTGGCTCCTCTGGTCAGCCTTCAGCCCCTATGCAGTGTGGCAGAGGAAG
GACATCCTTTTTCAGATCTGCTATGGAATGTATGGTTTTATGGATCTAGTGTGCATAGGTCTCATTGTT
CATGAAGGAGCTGCAGTTTACAGAGTGTTTAAGCGCTGGCGAGCTGTGAATTTGCACTGGGATGTGTTA
AATTATGACAAAGCCACAGACATCGAAGAAAGCAGCCGGGGAGAGTCTTCCACAAGTAGGACTTTGTGG
TTGCCATTGACAGCTCTGCGGAACAGAAACTTGGTCCACCCAACTCAGTTAACCTCACCAAGGTTTCAG
TGTGGCTATGTGTTATTGCACCTGTTCAATCGGATGAGGCCCCATGAAGACTTATCAGAAGATAACAGC
TCGGGGGAGGTTGTGATGAGAGTGACTTCAGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001102562
Insert Size 1209 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001102562.1
RefSeq Size 1528 bp
RefSeq ORF 1209 bp
Locus ID 441061
UniProt ID A6NNE9
Cytogenetics 5p15.1
MW 43.9 kDa
Gene Summary MARCH11 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). These enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their intracellular transport. March11 appears to have a role in ubiquitin-mediated protein sorting in the trans-Golgi network (TGN)-multivesicular body (MVB) transport pathway (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.