GGT5 (NM_001099782) Human Untagged Clone

CAT#: SC316775

GGT5 (untagged)-Human gamma-glutamyltransferase 5 (GGT5), transcript variant 3

USD 876.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GGT5 (NM_001099782) Human Untagged Clone
Symbol GGT5
Synonyms GGL; GGT 5; GGT-REL; GGTLA1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001099782, the custom clone sequence may differ by one or more nucleotides


ATGGCCCGGGGCTACGGGGCCACGGTCAGCCTAGTCCTGCTGGGTCTGGGGCTGGCGCTGGCTGTCATTG
TGCTGGCTGTGGTCCTCTCTCGACACCAGGCCCCATGTGGCCCCCAGGCCTTTGCCCACGCTGCTGTTGC
CGCCGACTCCAAGGTCTGCTCGGATATTGGACGAGCCATCCTCCAGCAGCAGGGCTCACCCGTGGATGCC
ACCATCGCGGCTCTGGTCTGCACCAGCGTCGTCAACCCTCAGAGCATGGGCCTGGGCGGAGGGGTCATCT
TCACCATCTACAATGTGACAACAGGGGCCCAGTGGATCGGGGTGCCCGGGGAGCTCCGTGGCTATGCCGA
GGCCCACCGCCGCCATGGCCGCCTGCCCTGGGCGCAGCTGTTCCAGCCCACCATCGCGCTGCTCCGAGGG
GGGCATGTGGTGGCCCCTGTCCTCAGCCGTTTCCTGCACAACAGCATCCTGCGGCCTTCCTTGCAGGCGT
CAACCCTGCGCCAGCTCTTCTTCAACGGGACAGAACCCCTGAGGCCTCAGGACCCACTCCCATGGCCTGC
ACTGGCCACCACCCTGGAGACCGTGGCCACAGAGGGCGTGGAGGTCTTCTACACGGGGAGGCTGGGCCAG
ATGCTGGTGGAGGACATTGCCAAGGAAGGGAGCCAGCTGACGCTGCAGGACCTGGCCAAGTTCCAGCCCG
AGGTGGTGGATGCCCTGGAGGTGCCCCTGGGGGACTATACCCTGTACTCACCACCGCCGCCTGCAGGGGG
TGCCATTCTCAGCTTTATCCTCAACGTGCTAAGAGGGTTCAACTTCTCAACAGAGTCTATGGCCAGGCCT
GAAGGGAGGGTGAACGTGTACCACCACCTTGTAGAGACGCTCAAGTTTGCCAAGGGGCAGAGGTGGAGGC
TGGGGGACCCTCGAAGCCACCCGAAGCTCCAGAATGCCTCCCGGGACCTGCTGGGGGAGACCCTGGCCCA
GCTCATCCGCCAACAGATCGATGGCCGGGGGGACCACCAGCTCAGCCACTACAGCTTGGCCGAGGCCTGG
GGCCACGGGACAGGCACGTCCCATGTGTCTGTGCTGGGGGAGGATGGCAGCGCCGTGGCTGCCACCAGCA
CCATCAACACACCCTTTGGAGCGATGGTGTATTCACCACGGACAGGCATCATCCTCAACAACGAGCTCCT
GGACTTATGCGAGCGATGCCCCCGGGGTTCCGGCACCACCCCCTCACCTGTGAGTGGAGACAGGGTGGGT
GGAGCTCCCGGAAGGTGCTGGCCCCCAGTTCCAGGCGAGCGTTCCCCATCCTCCATGGTGCCCTCCATCT
TGATCAACAAAGCCCAGGGGTCGAAGCTAGTGATTGGCGGGGCTGGCGGGGAGCTCATCATCTCTGCTGT
GGCCCAGGCCATCATGAGCAAGCTGTGGCTTGGCTTTGACCTGAGAGCGGCCATTGCAGCCCCCATCCTG
CATGTCAACAGCAAGGGCTGTGTGGAGTACGAGCCCAACTTCAGCCAGGAGGTGCAGAGGGGACTCCAAG
ACCGTGGCCAGAACCAGACCCAGAGGCCCTTCTTCCTGAACGTGGTCCAGGCTGTGTCCCAGGAGGGGGC
CTGTGTGTACGCCGTCTCGGACCTGAGGAAGAGTGGGGAGGCCGCAGGCTACTAA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001099782
ORF Size 1665 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001099782.2, NP_001093252
RefSeq Size 2415
Locus ID 2687
Cytogenetics 22q11.23
Protein Families Transmembrane, Protease
Protein Pathways Taurine and hypotaurine metabolism, Selenoamino acid metabolism, Cyanoamino acid metabolism, Glutathione metabolism, Arachidonic acid metabolism, Metabolic pathways
Gene Summary This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014].
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.