IKK gamma (IKBKG) (NM_001099857) Human Untagged Clone
IKBKG (untagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 1
"NM_001099857" in other vectors (6)
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IKBKG |
Synonyms | AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001099857, the custom clone sequence may differ by one or more nucleotides
ATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATC AGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGC TCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAG ATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCA TGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCA GAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAGCAGCAGATGGCTGAGGACAAGGCC TCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAGCTGCAGGAGAGCCAGAGTCGCTTGGAGGCTGCCA CTAAGGAATGCCAGGCTCTGGAGGGTCGGGCCCGGGCGGCCAGCGAGCAGGCGCGGCAGCTGGAGAGTGA GCGCGAGGCGCTGCAGCAGCAGCACAGCGTGCAGGTGGACCAGCTGCGCATGCAGGGCCAGAGCGTGGAG GCCGCGCTCCGCATGGAGCGCCAGGCCGCCTCGGAGGAGAAGAGGAAGCTGGCCCAGTTGCAGGTGGCCT ATCACCAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGTGAGCGGAAGCGAGG AATGCAGCTGGAAGATCTCAAACAGCAGCTCCAGCAGGCCGAGGAGGCCCTGGTGGCCAAACAGGAGGTG ATCGATAAGCTGAAGGAGGAGGCCGAGCAGCACAAGATTGTGATGGAGACCGTTCCGGTGCTGAAGGCCC AGGCGGATATCTACAAGGCGGACTTCCAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCCGAGAAGAAGGA GCTCCTGCAGGAGCAGCTGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGCTGTCAGGAGTCG GCCAGGATCGAGGACATGAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCTGCCT ACCTCTCCTCTCCCCTGGCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCACCTGACTTCTGCTG TCCCAAGTGCCAGTATCAGGCCCCTGATATGGACACCCTGCAGATACATGTCATGGAGTGCATTGAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001099857 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001099857.2, NP_001093327.1 |
RefSeq Size | 2279 bp |
RefSeq ORF | 1260 bp |
Locus ID | 8517 |
UniProt ID | Q9Y6K9 |
Cytogenetics | Xq28 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, MAPK signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Primary immunodeficiency, Prostate cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway |
Gene Summary | This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a. Variants 1, 3 and 5 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
cDNA Clone Resources |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218044 | IKBKG (Myc-DDK-tagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 1 |
USD 477.00 |
|
RC218044L1 | Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC218044L2 | Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 1, mGFP tagged |
USD 768.00 |
|
RC218044L3 | Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC218044L4 | Lenti ORF clone of Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 1, mGFP tagged |
USD 768.00 |
|
RG218044 | IKBKG (GFP-tagged) - Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 1 |
USD 517.00 |
USD 417.00
USD 473.00
USD 149.00
USD 55.00