APRIL (TNFSF13) (NM_172088) Human Untagged Clone
CAT#: SC316690
TNFSF13 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant gamma
"NM_172088" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | APRIL |
Synonyms | APRIL; CD256; TALL-2; TALL2; TNLG7B; TRDL-1; UNQ383/PRO715; ZTNF2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316690 representing NM_172088.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCAGCCTCATCTCCTTTCTTGCTAGCCCCCAAAGGGCCTCCAGGCAACATGGGGGGCCCAGTCAGA GAGCCGGCACTCTCAGTTGCCCTCTGGTTGAGTTGGGGGGCAGCTCTGGGGGCCGTGGCTTGTGCCATG GCTCTGCTGACCCAACAAACAGAGCTGCAGAGCCTCAGGAGAGAGGTGAGCCGGCTGCAGGGGACAGGA GGCCCCTCCCAGAATGGGGAAGGGTATCCCTGGCAGAGTCTCCCGGAGCAGAGTTCCGATGCCCTGGAA GCCTGGGAGAATGGGGAGAGATCCCGGAAAAGGAGAGCAGTGCTCACCCAAAAACAGAAGAAGCAGCAC TCTGTCCTGCACCTGGTTCCCATTAACGCCACCTCCAAGGATGACTCCGATGTGACAGAGGTGATGTGG CAACCAGCTCTTAGGCGTGGGAGAGGCCTACAGGCCCAAGGATATGGTGTCCGAATCCAGGATGCTGGA GTTTATCTGCTGTATAGCCAGGTCCTGTTTCAAGACGTGACTTTCACCATGGGTCAGGTGGTGTCTCGA GAAGGCCAAGGAAGGCAGGAGACTCTATTCCGATGTATAAGAAGTATGCCCTCCCACCCGGACCGGGCC TACAACAGCTGCTATAGCGCAGGTGTCTTCCATTTACACCAAGGGGATATTCTGAGTGTCATAATTCCC CGGGCAAGGGCGAAACTTAACCTCTCTCCACATGGAACCTTCCTGGGACTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_172088 |
Insert Size | 744 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172088.2 |
RefSeq Size | 2112 bp |
RefSeq ORF | 744 bp |
Locus ID | 8741 |
UniProt ID | O75888 |
Cytogenetics | 17p13.1 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
MW | 27.1 kDa |
Gene Summary | The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (gamma) lacks an alternate segment in the 3' coding region and 3' UTR, compared to variant alpha, resulting in an isoform (gamma) that has a distinct and shorter C-terminus, compared to isoform alpha. It is not known whether this isoform (gamma) is proteolytically processed in the same manner as isoforms alpha and beta. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203446 | TNFSF13 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant gamma |
USD 300.00 |
|
RC203446L3 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant gamma, Myc-DDK-tagged |
USD 600.00 |
|
RC203446L4 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant gamma, mGFP tagged |
USD 600.00 |
|
RG203446 | TNFSF13 (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant gamma |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review