Growth hormone receptor(GHR) (NM_000163) Human Untagged Clone

CAT#: SC316411

GHR (untagged)-Human growth hormone receptor (GHR)

USD 1,020


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Growth hormone receptor(GHR) (NM_000163) Human Untagged Clone
Symbol GHR
Synonyms GHBP; GHIP
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000163 edited
ATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTTTTTCT
GGAAGTGAGGCCACAGCAGCTATCCTTAGCAGAGCACCCTGGAGTCTGCAAAGTGTTAAT
CCAGGCCTAAAGACAAATTCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCACCTGAG
CGAGAGACTTTTTCATGCCACTGGACAGATGAGGTTCATCATGGTACAAAGAACCTAGGA
CCCATACAGCTGTTCTATACCAGAAGGAACACTCAAGAATGGACTCAAGAATGGAAAGAA
TGCCCTGATTATGTTTCTGCTGGGGAAAACAGCTGTTACTTTAATTCATCGTTTACCTCC
ATCTGGATACCTTATTGTATCAAGCTAACTAGCAATGGTGGTACAGTGGATGAAAAGTGT
TTCTCTGTTGATGAAATAGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTG
AACGTCAGTTTAACTGGGATTCATGCAGATATCCAAGTGAGATGGGAAGCACCACGCAAT
GCAGATATTCAGAAAGGGTGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAAT
GAAACTAAATGGAAAATGATGGACCCTATATTGACAACATCAGTTCCAGTGTACTCATTG
AAAGTGGATAAGGAATATGAAGTGCGTGTGAGATCCAAACAACGAAACTCTGGAAATTAT
GGCGAGTTCAGTGAGGTGCTCTATGTAACACTTCCTCAGATGAGCCAATTTACATGTGAA
GAAGATTTCTACTTTCCATGGCTCTTAATTATTATCTTTGGAATATTTGGGCTAACAGTG
ATGCTATTTGTATTCTTATTTTCTAAACAGCAAAGGATTAAAATGCTGATTCTGCCCCCA
GTTCCAGTTCCAAAGATTAAAGGAATCGATCCAGATCTCCTCAAGGAAGGAAAATTAGAG
GAGGTGAACACAATCTTAGCCATTCATGATAGCTATAAACCCGAATTCCACAGTGATGAC
TCTTGGGTTGAATTTATTGAGCTAGATATTGATGAGCCAGATGAAAAGACTGAGGAATCA
GACACAGACAGACTTCTAAGCAGTGACCATGAGAAATCACATAGTAACCTAGGGGTGAAG
GATGGCGACTCTGGACGTACCAGCTGTTGTGAACCTGACATTCTGGAGACTGATTTCAAT
GCCAATGACATACATGAGGGTACCTCAGAGGTTGCTCAGCCACAGAGGTTAAAAGGGGAA
GCAGATCTCTTATGCCTTGACCAGAAGAATCAAAATAACTCACCTTATCATGATGCTTGC
CCTGCTACTCAGCAGCCCAGTGTTATCCAAGCAGAGAAAAACAAACCACAACCACTTCCT
ACTGAAGGAGCTGAGTCAACTCACCAAGCTGCCCATATTCAGCTAAGCAATCCAAGTTCA
CTGTCAAACATCGACTTTTATGCCCAGGTGAGCGACATTACACCAGCAGGTAGCGTGGTC
CTTTCCCCGGGCCAAAAGAATAAGGCAGGGATGTCCCAATGTGACATGCACCCGGAAATG
GTCTCACTCTGCCAAGAAAACTTCCTTATGGACAATGCCTACTTCTGTGAGGCAGATGCC
AAAAAGTGCATCCCTGTGGCTCCTCACATCAAGGTTGAATCACACATACAGCCAAGCTTA
AACCAAGAGGACATTTACATCACCACAGAAAGCCTTACCACTGCTGCTGGGAGGCCTGGG
ACAGGAGAACATGTTCCAGGTTCTGAGATGCCTGTCCCAGACTATACCTCCATTCATATA
GTACAGTCCCCACAGGGCCTCATACTCAATGCGACTGCCTTGCCCTTGCCTGACAAAGAG
TTTCTCTCATCATGTGGCTATGTGAGCACAGACCAACTGAACAAAATCATGCCTTAG
Tag Tag Free
ACCN NM_000163
ORF Size 1917 bp
Insert Size 1900
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000163.2, NP_000154
RefSeq Size 4370
RefSeq ORF 1917
Locus ID 2690
Cytogenetics 5p13.1-p12
Protein Families Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Neuroactive ligand-receptor interaction, Jak-STAT signaling pathway
Gene Summary Isoform 2 up-regulates the production of GHBP and acts as a negative inhibitor of GH signaling. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1, also known as V2) and variants 3 through 9 encode the predominant protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.