TCF4(TCF4) (NM_001083962) Human Untagged Clone

CAT#: SC316252

TCF4 (untagged)-Human transcription factor 4 (TCF4), transcript variant 1

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TCF4(TCF4) (NM_001083962) Human Untagged Clone
Symbol TCF4
Synonyms bHLHb19; E2-2; ITF-2; ITF2; PTHS; SEF-2; SEF2; SEF2-1; SEF2-1A; SEF2-1B; SEF2-1D; TCF-4
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001083962 edited
ATGGAGAGAGCGATGGAGCAACTCAACCGCCTGACGCGCTCGCTGCGCCGCGCGCGCACC
GTGGAGTTGCCCGAGGATAATGAAACTGCTGTTTATACATTAATGCCAATGGTTATGGCT
GATCAACACAGGTCTGTTTCTGAACTACTATCAAATTCAAAATTTGATGTCAATTATGCA
TTCGGACGTGTGAAAAGAAGCTTGCTTCACATTGCAGCAAATTGTGGATCGGTGGAATGC
TTGGTTTTGCTGTTAAAGAAAGGAGCAAATCCTAACTATCAAGATATTTCAGGCTGTACA
CCCCTTCATTTGGCAGCAAGAAATGGGCAGAAGAAATGTATGAGTAAATTATTAGAATAT
AGCGCTGATGTCAACATTTGTAATAATGAAGGCCTTACAGCAATACATTGGCTGGCTGTG
AATGGGCGGACAGAACTACTCCATGACCTTGTGCAGCATGTCAGTGATGTTGATGTTGAG
GATGCCATGGGGCAGACAGCACTGCATGTTGCCTGCCAGAACGGTCACAAGACGACAGTG
CAGTGCTTGCTAGACAGTGGTGCTGATATTAACAGGCCAAATGTATCAGGAGCAACTCCA
TTGTACTTTGCTTGCAGTCATGGTCAGAGAGATACAGCACAGATCCTACTATTACGAGGA
GCCAAATATCTGCCAGATAAAAATGGAGTAACTCCTCTGGATTTATGTGTACAGGGTGGA
TATGGAGAGACTTGTGAAGTATTAATTCAATATCACCCGAGGCTTTTTCAGACTATTATT
CAAATGACACAGAATGAAGACCTCCGAGAAAACATGTTACGGCAAGTTCTGGAGCATTTG
TCTCAGCAAAGTGAAAGCCAGTACCTAAAGATTCTAACAAGCCTTGCTGAAGTTGCTACA
ACAAATGGTCATAAACTGCTTAGCCTCTCTAGCAATTATGATGCTCAAATGAAGAGCCTT
TTAAGGATTGTGAGAATGTTTTGTCACGTCTTTCGAATTGGTCCATCCTCCCCCAGTAAT
GGAATTGATATGGGCTACAATGGGAATAAAACTCCAAGAAGCCAGGTGTTCAAGCCTCTG
GAATTGCTTTGGCACTCGTTAGATGAATGGCTAGTTTTAATAGCCACAGAATTGATGAAA
AACAAAAGAGACTCAACAGAGATCACTTCTATTTTACTGAAACAAAAAGGCCAAGATCAA
GATGCTGCTTCCATTCCTCCATTTGAACCTCCAGGACCTGGGAGCTATGAAAATCTGTCC
ACTGGCACAAGGGAATCTAAACCAGATGCTCTTGCAGGGAGACAGGAAGCCAGTGCAGAT
TGTCAGGATGTTATTTCTATGACAGCTAACCGGCTAAGTGCTGTCATTCAAGCTTTTTAC
ATGTGCTGTTCTTGTCAGATGCCTCCGGGAATGACTTCACCTCGTTTCATTGAATTTGTC
TGCAAACATGATGAAGTTTTAAAATGCTTTGTTAATAGAAATCCCAAAATTATATTTGAC
CACTTTCACTTTCTCCTTGAATGTCCTGAGTTGATGTCAAGATTCATGCATATCATAAAA
GCACAGCCTTTTAAAGATCGCTGTGAATGGTTCTATGAACATTTGCATTCAGGACAGCCA
GATTCAGATATGGTGCACAGGCCAGTGAATGAAAATGATATCCTGCTGGTTCACAGAGAT
TCTATTTTTAGGAGTAGCTGTGAAGTTGTGTCAAAAGCAAATTGTGCAAAGCTAAAGCAA
GGGATTGCTGTACGGTTCCATGGAGAAGAAGGCATGGGTCAAGGTGTTGTGCGTGAGTGG
TTTGATATTCTGTCCAATGAGATAGTCAATCCTGATTATGCATTGTTTACCCAGTCAGCT
GATGGAACAACTTTTCAGCCTAATAGCAACTCTTATGTAAATCCTGATCACTTGAACTAT
TTTCGGTTTGCTGGGCAGATCTTGGGATTAGCGTTGAACCACAGGCAGCTGGTCAATATT
TACTTCACACGATCCTTCTACAAGCACATTCTTGGTATTCCTGTAAATTACCAAGATGTG
GCATCCATTGATCCAGAATATGCGAAAAATTTGCAATGGATTTTAGATAATGATATAAGT
GATCTGGGTCTAGAACTAACTTTTTCTGTTGAGACTGATGTGTTTGGAGCAATGGAAGAG
GTGCCTTTGAAACCTGGGGGTGGGAGTATTCTTGTGACACAAAATAATAAAGCGGAGTAC
GTCCAGCTTGTTACTGAACTTCGAATGACAAGAGCCATTCAGCCTCAGATCAATGCTTTT
TTACAGGGCTTTCATATGTTCATTCCACCCTCCCTCATACAGCTTTTTGATGAATATGAA
TTGGAGCTACTGCTTTCTGGCATGCCAGAAATTGATGTGAGTGATTGGATAAAAAATACA
GAATACACAAGTGGCTATGAAAGAGAAGATCCAGTTATTCAGTGGTTCTGGGAAGTTGTA
GAAGACATTACTCAAGAGGAGAGAGTTCTTCTCTTACAGTTTGTTACGGGCAGTTCCAGG
GTCCCACATGGTGGGTTTGCTAATATCATGGGTGGAAGTGGATTGCAAAACTTTACAATC
GCTGCTGTGCCATATACTCCAAATCTTTTACCAACTTCAAGCACATGCATCAACATGCTC
AAGTTACCTGAATACCCAAGTAAAGAAATACTCAAGGACAGACTTCTTGTGGCACTACAT
TGTGGCAGCTATGGTTACACAATGGCAACGCGTACGCGGCCGCTCGAGCAGAAACTCATC
TCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTT
TAAAC
Tag Tag Free
ACCN NM_001083962
ORF Size 2016 bp
Insert Size 2200
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation ORF sequence matches with the reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001083962.1, NP_001077431
RefSeq Size 8332
RefSeq ORF 2016
Locus ID 6925
Cytogenetics 18q21.2
Protein Families ES Cell Differentiation/IPS, Transcription Factors, Druggable Genome
Gene Summary This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016].
Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence compared to variant 3. The resulting isoform (a, also known as TCF4-B+) is shorter at the N-terminus compared to isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.