RNF20 (NM_019592) Human Untagged Clone

CAT#: SC315020

Reviews ()
Write a review

RNF20 (untagged)-Human ring finger protein 20 (RNF20)



Reconstitution Protocol

USD 894.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNF20
Synonyms BRE1; BRE1A; hBRE1
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_019592 edited
TTCTGCCTTGTCTCCGCCGCGGGTCAGGGGTGAGAGCTGGAATCTCTGCACGGGCCTTGG
AAAACGACTGTCTTCTTCTGCCAAAATGTCAGGAATTGGAAATAAAAGAGCAGCTGGAGA
ACCTGGCACCTCCATGCCTCCTGAGAAGAAGGCAGCTGTTGAAGATTCAGGGACCACAGT
GGAAACAATTAAGCTAGGAGGTGTCTCTTCAACGGAGGAACTAGACATTAGAACACTGCA
AACCAAAAATCGCAAGCTGGCAGAAATGTTGGATCAGCGGCAGGCCATTGAAGATGAACT
TCGTGAGCACATTGAAAAACTGGAACGACGACAGGCCACTGATGATGCCTCACTATTGAT
TGTCAACCGATACTGGAGTCAGTTTGATGAAAACATCCGTATCATCCTTAAACGTTATGA
TCTGGAGCAGGGCTTGGGAGACCTACTCACAGAACGAAAAGCCCTTGTTGTGCCTGAACC
AGAACCAGACTCTGATAGCAATCAGGAGCGTAAAGATGACCGAGAGAGAGGGGAAGGGCA
AGAGCCAGCTTTCTCTTTCCTTGCTACTTTGGCCAGCAGTTCCAGTGAAGAGATGGAGTC
TCAGCTGCAGGAACGTGTGGAGTCTTCCCGCCGAGCCGTGTCCCAGATTGTGACTGTTTA
TGATAAATTGCAAGAAAAAGTGGAGCTCTTATCCCGGAAGCTAAACAGTGGAGATAATCT
GATAGTGGAGGAAGCAGTGCAGGAGCTGAACTCTTTCCTCGCACAGGAGAATATGAGGCT
ACAGGAATTGACAGATCTTCTTCAGGAAAAGCATCGCACCATGTCTCAGGAGTTCTCCAA
GTTGCAGAGTAAAGTGGAGACAGCCGAATCACGAGTGTCTGTCCTGGAGTCCATGATTGA
TGACCTGCAGTGGGATATTGACAAAATTCGAAAGAGGGAACAGCGACTCAACCGACACTT
AGCAGAAGTCCTAGAACGGGTGAATTCCAAAGGTTATAAGGTGTATGGAGCGGGGAGCAG
TCTGTATGGCGGCACAATCACTATCAATGCTCGGAAGTTTGAGGAAATGAATGCAGAGCT
TGAGGAGAACAAAGAGTTGGCTCAGAACCGTCTCTGTGAGCTGGAGAAACTTCGGCAAGA
CTTTGAGGAGGTCACTACACAAAATGAAAAGCTGAAGGTGGAATTGCGGAGTGCAGTGGA
GCAAGTCGTTAAGGAAACTCCAGAATATCGCTGCATGCAGTCACAGTTCTCCGTCTTGTA
TAATGAGAGCCTACAGTTGAAAGCACACTTGGATGAGGCTCGGACCCTGCTTCATGGCAC
CAGAGGAACCCACCAGCACCAGGTTGAGCTTATTGAGCGAGATGAGGTTAGTCTTCATAA
GAAGCTGAGGACTGAAGTAATTCAGCTAGAAGATACATTGGCCCAGGTCCGCAAGGAGTA
TGAAATGCTGAGGATAGAATTTGAGCAGACCCTTGCTGCCAATGAACAAGCAGGCCCTAT
AAACAGGGAGATGCGCCACCTCATCAGTAGCCTCCAGAATCACAATCACCAGCTGAAAGG
GGAGGTCCTGAGATATAAGCGGAAATTGAGAGAAGCCCAGTCTGACCTGAACAAGACACG
CCTGCGTAGTGGTAGTGCCCTCCTGCAGTCCCAGTCTAGTACTGAGGACCCGAAGGATGA
GCCTGCGGAGCTAAAACCAGATTCTGAGGACTTATCCTCCCAGTCCTCAGCTTCAAAGGC
ATCTCAGGAGGATGCCAATGAAATCAAGTCTAAACGGGATGAAGAAGAACGAGAACGAGA
AAGGAGGGAGAAGGAGAGGGAACGAGAAAGAGAACGGGAGAAGGAGAAGGAGAGAGAACG
AGAGAAGCAGAAGCTAAAAGAGTCAGAAAAAGAGAGAGATTCTGCTAAGGATAAAGAGAA
AGGCAAACATGATGATGGACGGAAAAAGGAAGCAGAAATTATCAAACAATTGAAGATTGA
ACTCAAGAAGGCACAGGAGAGCCAAAAGGAGATGAAACTATTGCTGGATATGTACCGTTC
TGCCCCAAAGGAACAGAGAGACAAAGTTCAGCTGATGGCAGCTGAGAAGAAGTCTAAGGC
AGAGTTGGAAGATCTAAGGCAAAGACTCAAGGATCTGGAAGATAAAGAGAAGAAAGAGAA
CAAGAAAATGGCTGATGAGGATGCCTTGAGGAAGATCCGGGCAGTGGAGGAGCAGATAGA
ATACCTACAGAAGAAGCTAGCCATGGCCAAGCAGGAAGAAGAAGCACTCCTCTCTGAAAT
GGATGTCACAGGCCAGGCCTTTGAAGACATGCAGGAGCAAAATATCCGTTTGATGCAGCA
ATTGCGGGAGAAGGATGATGCAAATTTCAAGCTCATGTCAGAGCGTATCAAGTCCAATCA
GATCCATAAGTTGCTTAAAGAAGAGAAGGAGGAGCTGGCAGACCAGGTGTTGACTCTGAA
GACTCAGGTTGATGCCCAGCTACAGGTAGTAAGGAAACTGGAAGAGAAGGAGCATCTGTT
ACAGAGCAACATTGGCACAGGGGAGAAAGAGCTGGGTCTTAGGACCCAAGCCTTAGAGAT
GAATAAACGCAAGGCAATGGAGGCAGCCCAGCTTGCAGATGACCTCAAAGCACAACTGGA
GTTGGCTCAGAAGAAGCTACATGATTTTCAGGATGAGATCGTGGAGAACAGTGTTACCAA
AGAAAAGGACATGTTCAATTTCAAACGAGCCCAGGAGGACATCTCTAGACTTCGCAGGAA
GCTGGAGACCACAAAGAAACCAGACAATGTACCCAAGTGTGATGAGATTCTGATGGAAGA
GATTAAGGATTACAAGGCACGCTTGACCTGTCCGTGCTGTAACATGCGTAAAAAGGATGC
TGTTCTTACTAAGTGTTTTCATGTCTTCTGCTTTGAGTGTGTGAAGACACGCTATGACAC
CCGCCAGCGCAAATGTCCCAAGTGTAATGCTGCTTTTGGTGCCAATGATTTTCATCGCAT
CTACATTGGTTGATCTAAGTCAAGAGAAGAAGAGGAGCTGGCTAGTCAGGAACTTATTCA
TTAACCACCAAACCTCTACCTCTTCTCTCCTTGACTGTCACCTGTAGGACAGTTTATCAG
TCAACTACCTTTCCTCCAGACTTTACTTCCAGGCTCTCCTCTTCAGTAGCTGGATGACTT
TAGCAGAAAGGACTGGTAAATACAAGCCTTGGGTTTCAGAATGAATTAGAAACAAATAAC
TCTTACTGTCTTCCCTCCCAGCTTTGTTTATTTTGTGCTTTTAGACTTTTCAGTGTTTTC
TTTTTCCAGCCCACTGTATAAACTTGGATTGTCCATTCCTCCTGAAGAAATCAAGTTGGT
ATTTTTGATGTGGAAAAGGGAACAAAAGTGGAAACATGGCTACTTTTGGGGAGTGATATT
TTAAAAAATAAGTTGTCTATGGGCACAAAGTTTTCTTCATTTGTGTAGCAAACTTCTTGT
GAATGTGGATTACAAAATGGTATAATTGTGCTACTCTCCCCTGGGTGGTTTGCAGCCCTA
ATGAAATTATGTCTAGGATGATTCAGTCTATTTCCCATTTACTAGCAGAGTAACTTGTTA
AGATCAGCTGGCTTTCTTGTTAAAGTTATTTAAGTTTTGAATGCTCTACTACTTCAAGTC
TTTAAATTTCTTGAGACTAGAATAATTTTAAATAATATGACCCTTTGTCTTCTAATGAAA
TAAAGATTGAAGAGGTTGAGTATAGTCC
Restriction Sites Please inquire     
ACCN NM_019592
Insert Size 4700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_019592.5.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019592.5, NP_062538.5
RefSeq Size 3970 bp
RefSeq ORF 2928 bp
Locus ID 56254
UniProt ID Q5VTR2
Cytogenetics 9q31.1
Domains RING
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Other products for "RNF20"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.