SCYL1BP1 (GORAB) (NM_152281) Human Untagged Clone

SKU
SC313280
GORAB (untagged)-Human golgin, RAB6-interacting (GORAB), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SCYL1BP1
Synonyms GO; NTKLBP1; SCYL1BP1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_152281 edited
ATGAGCTGGGCAGCAGTGTTGGCAGTCGCGGCTGCGAGATTTGGGCACTTTTGGGGGTGC
CGGTGGCCCGGGCCGATGGCGCAAGGTTGGGCAGGCTTCTCTGAGGAGGAACTGAGGAGA
CTAAAGCAGACTAAAGATCCATTTGAACCACAGCGACGTCTCCCCGCGAAGAAAAGTCGA
CAACAACTTCAGCGAGAAAAAGCCCTTGTAGAGCAAAGCCAAAAACTTGGGCTTCAAGAT
GGATCAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACCAAAACAGAGAGTTAACGTT
CAAAAACCACCTTTTTCTTCCCCTACTCTTCCGAGTCATTTCACTCTCACCTCCCCCGTT
GGTGATGGACAACCACAGGGCATTGAAAGTCAGCCAAAGGAACTGGGACTTGAGAATTCC
CATGATGGTCACAACAATGTTGAGATTCTACCTCCAAAGCCAGATTGCAAATTGGAGAAA
AAGAAAGTGGAATTGCAAGAAAAATCTCGTTGGGAAGTCCTCCAACAAGAACAACGGCTA
ATGGAAGAGAAAAATAAACGTAAAAAAGCTCTTTTGGCTAAAGCTATTGCAGAAAGATCC
AAAAGAACTCAGGCAGAGACCATGAAACTAAAGCGGATCCAGAAGGAGTTGCAGGCTTTA
GATGACATGGTGTCAGCTGACATTGGAATTCTCAGGAACCGGATTGATCAGGCCAGCTTA
GACTATTCATACGCTCGGAAGCGGTTTGACAGGGCTGAAGCAGAGTACATTGCAGCAAAG
CTAGATATACAGCGCAAGACTGAGATAAAAGAGCAACTCACTGAACACCTTTGTACGATC
ATACAGCAAAATGAGCTCCGAAAGGCCAAGAAGTTGGAGGAGTTGATGCAACAACTAGAT
GTAGAAGCCGATGAAGAGACTTTGGAGCTTGAGGTGGAGGTCGAGAGATTGCTACACGAA
CAAGAAGTAGAATCAAGGAGACCAGTGGTTCGTTTAGAGAGGCCATTTCAGCCTGCGGAG
GAGAGTGTGACATTAGAATTTGCTAAAGAGAACAGAAAGTGTCAAGAACAAGCTGTTTCC
CCAAAGGTAGATGACCAGTGTGGAAATTCCAGTAGCATCCCCTTTCTTAGTCCAAACTGC
CCAAATCAAGAAGGTAATGACATTTCAGCTGCTTTGGCCACATGA
Restriction Sites Please inquire
ACCN NM_152281
Insert Size 2600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone has been fully sequenced and found four SNPs within the protein associated with this reference, NM_152281.1. Three of four SNPs result in amino acid change.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152281.1, NP_689494.1
RefSeq Size 2186 bp
RefSeq ORF 1185 bp
Locus ID 92344
UniProt ID Q5T7V8
Cytogenetics 1q24.2
Domains DUF662
Summary This gene encodes a member of the golgin family, a group of coiled-coil proteins localized to the Golgi. The encoded protein may function in the secretory pathway. The encoded protein, which also localizes to the cytoplasm, was identified by interactions with the N-terminal kinase-like protein, and thus it may function in mitosis. Mutations in this gene have been associated with geroderma osteodysplastica. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (1) encodes the longer isoform (a).
Write Your Own Review
You're reviewing:SCYL1BP1 (GORAB) (NM_152281) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212883 GORAB (Myc-DDK-tagged)-Human golgin, RAB6-interacting (GORAB), transcript variant 1 10 ug
$457.00
RC212883L3 Lenti ORF clone of Human golgin, RAB6-interacting (GORAB), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC212883L4 Lenti ORF clone of Human golgin, RAB6-interacting (GORAB), transcript variant 1, mGFP tagged 10 ug
$757.00
RG212883 GORAB (tGFP-tagged) - Human golgin, RAB6-interacting (GORAB), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.