SPTSSB (NM_001040100) Human Untagged Clone

CAT#: SC310957

SPTSSB (untagged)-Human chromosome 3 open reading frame 57 (C3orf57)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPTSSB
• Synonyms: ADMP; C3orf57; SSSPTB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC310957 representing NM_001040100.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGATTTGAGGCGTGTGAAGGAATATTTCTCCTGGCTCTACTATCAATACCAAATCATTAGCTGCTGT
  GCTGTTTTAGAGCCCTGGGAGCGATCTATGTTTAACACCATCTTACTAACCATTATTGCTATGGTGGTA
  TACACTGCCTATGTCTTTATTCCAATCCACATTCGCCTGGCTTGGGAATTTTTCTCAAAAATATGTGGA
  TATCACAGTACAATTTCTAATTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040100
• Insert Size: 231 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001040100.1
• RefSeq Size: 2306 bp
• RefSeq ORF: 231 bp
• Locus ID: 165679
• UniProt ID: Q8NFR3
• Cytogenetics: 3q26.1
• Protein Families: Transmembrane
• MW: 9.2 kDa
• Gene Summary: Serine palmitoyltransferase (SPT; EC 2.3.1.50) catalyzes the first committed and rate-limiting step in sphingolipid biosynthesis. SSSPTB is a small SPT subunit that stimulates SPT activity and confers acyl-CoA preference to the SPT catalytic heterodimer of SPTLC1 (MIM 605712) and either SPTLC2 (MIM 605713) or SPTLC3 (MIM 611120) (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.