GPCR MRGE(MRGPRE) (NM_001039165) Human Untagged Clone

CAT#: SC310855

TrueClone®, MRGPRE (untagged)-Human MAS-related GPR, member E (MRGPRE)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GPCR MRGE(MRGPRE) (NM_001039165) Human Untagged Clone
Symbol MRGPRE
Synonyms GPR167; MGRF; MRGE
Vector pCMV6-XL5
Sequence Data
>OriGene sequence for NM_001039165 edited
ACTCCTGCAGCATCCCCTGGCCCCCCGCCCCATGATGGAGCCCAGAGAAGCTGGACAGCA
CGTGGGGGCCGCCAACGGCGCCCAGGAGGATGTGGCCTTCAACCTCATCATCCTGTCCCT
CACCGAGGGGCTCGGCCTCGGTGGGCTGCTGGGGAATGGGGCAGTCCTCTGGCTGCTCAG
CTCCAATGTCTACAGAAACCCCTTCGCCATCTACCTCCTGGACGTGGCCTGCGCGGATCT
CATCTTCCTTGGCTGCCACATGGTGGCCATCGTCCCCGACTTGCTGCAAGGCCGGCTGGA
CTTCCCGGGCTTCGTGCAGACCAGCCTGGCAACGCTGCGCTTCTTCTGCTACATCGTGGG
CCTGAGTCTCCTGGCGGCCGTCAGCGTGGAGCAGTGCCTGGCCGCCCTCTTCCCAGCCTG
GTACTCGTGCCGCCGCCCACGCCACCTGACCACCTGTGTGTGCGCCCTCACCTGGGCCCT
CTGCCTGCTGCTGCACCTGCTGCTCAGCGGCGCCTGCACCCAGTTCTTCGGGGAGCCCAG
CCGCCACTTGTGCCGGACGCTGTGGCTGGTGGCAGCGGTGCTGCTGGCTCTGCTGTGTTG
CACCATGTGTGGGGCCAGCCTTATGCTGCTGCTGCGGGTGGAGCGAGGCCCCCAGCGGCC
CCCACCCCGGGGCTTCCCTGGGCTCATCCTCCTCACCGTCCTCCTCTTCCTCTTCTGCGG
CCTGCCCTTCGGCATCTACTGGCTGTCCCGGAACCTGCTCTGGTACATCCCCCACTACTT
CTACCACTTCAGCTTCCTCATGGCCGCCGTGCACTGCGCGGCCAAGCCCGTCGTCTACTT
CTGCCTGGGCAGTGCCCAGGGCCGCAGGCTGCCCCTCCGGCTGGTCCTCCAGCGAGCGCT
GGGAGACGAGGCTGAGCTGGGGGCCGTCAGGGAGACCTCCCGCCGGGGCCTGGTGGACAT
AGCAGCCTGAGCCCTGGGGGCCCCGACCCCAGCTGCAGCCCCCGTGAGGCAAGAGGGTGA
Tag Tag Free
ACCN NM_001039165
ORF Size 936 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001039165.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001039165.1, NP_001034254
RefSeq Size 1020
RefSeq ORF 936
Locus ID 116534
Cytogenetics 11p15.4
Protein Families Transmembrane, Druggable Genome
Gene Summary Orphan receptor. May regulate nociceptor function and/or development, including the sensation or modulation of pain. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.