HAGH (NM_001040427) Human Untagged Clone

CAT#: SC310725

TrueClone®, HAGH (untagged)-Human hydroxyacylglutathione hydrolase (HAGH), transcript variant 2

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HAGH (NM_001040427) Human Untagged Clone
Symbol HAGH
Synonyms GLO2; GLX2; GLXII; HAGH1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001040427, the custom clone sequence may differ by one or more nucleotides


ATGAAGGTAGAGGTGCTGCCTGCCCTGACCGACAACTACATGTACCTGGTCATTGATGATGAGACCAAGG
AGGCTGCCATTGTGGATCCGGTGCAGCCCCAGAAGGTCGTGGACGCGGCGAGAAAGCACGGGGTGAAACT
GACCACAGTGCTCACCACCCACCACCACTGGGACCATGCTGGCGGGAATGAGAAACTGGTCAAGCTGGAG
TCGGGACTGAAGGTGTACGGGGGTGACGACCGTATCGGGGCCCTGACTCACAAGATCACTCACCTGTCCA
CACTGCAGGTGGGGTCTCTGAACGTCAAGTGCCTGGCGACCCCGTGCCACACTTCAGGACACATTTGTTA
CTTCGTGAGCAAGCCCGGAGGCTCGGAGCCCCCTGCCGTGTTCACAGGTGACACCTTGTTTGTGGCTGGC
TGCGGGAAGTTCTATGAAGGGACTGCGGATGAGATGTGTAAAGCTCTGCTGGAGGTCTTGGGCCGGCTCC
CCCCGGACACAAGAGTCTACTGTGGCCACGAGTACACCATCAACAACCTCAAGTTTGCACGCCACGTGGA
GCCCGGCAATGCCGCCATCCGGGAGAAGCTGGCCTGGGCCAAGGAGAAGTACAGCATCGGGGAGCCCACA
GTGCCATCCACCCTGGCAGAGGAGTTTACCTACAACCCCTTCATGAGAGTGAGGGAGAAGACGGTGCAGC
AGCACGCAGGTGAGACGGACCCGGTGACCACCATGCGGGCCGTGCGCAGGGAGAAGGACCAGTTCAAGAT
GCCCCGGGACTGA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Tag Tag Free
ACCN NM_001040427
ORF Size 783 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001040427.1, NP_001035517
RefSeq Size 1648
RefSeq ORF 783
Locus ID 3029
Cytogenetics 16p13.3
Protein Families Druggable Genome
Protein Pathways Pyruvate metabolism
Gene Summary The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013].
Transcript Variant: This variant (2) includes an alternate exon in the 5' UTR and encodes the cytosolic protein isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.