PCDHGC3 (NM_032403) Human Untagged Clone

CAT#: SC310676

TrueClone®, PCDHGC3 (untagged)-Human protocadherin gamma subfamily C, 3 (PCDHGC3), transcript variant 3

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PCDHGC3 (NM_032403) Human Untagged Clone
Symbol PCDHGC3
Synonyms PC43; PCDH-GAMMA-C3; PCDH2
Vector pCMV6-XL
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032403, the custom clone sequence may differ by one or more nucleotides


ATGGTCCCAGAGGCCTGGAGGAGCGGACTGCAAGCCCCGCCCAACACGGACTGGCGTTTCTCTCAGGCCC
AGAGACCCGGCACCAGCGGCTCCCAAAATGGCGATGACACCGGCACCTGGCCCAACAACCAGTTTGACAC
AGAGATGCTGCAAGCCATGATCTTGGCGTCCGCCAGTGAAGCTGCTGATGGGAGCTCCACCCTGGGAGGG
GGTGCCGGCACCATGGGATTGAGCGCCCGCTACGGACCCCAGTTCACCCTGCAGCACGTGCCCGACTACC
GCCAGAATGTCTACATCCCAGGCAGCAATGCCACACTGACCAACGCAGCTGGCAAGCGGGATGGCAAGGC
CCCAGCAGGTGGCAATGGCAACAAGAAGAAGTCGGGCAAGAAGGAGAAGAAGTAA


Tag Tag Free
ACCN NM_032403
ORF Size 405 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_032403.1, NP_115779
RefSeq Size 2326
RefSeq ORF 405
Locus ID 5098
Cytogenetics 5q31.3
Protein Families Transmembrane
Gene Summary This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (3) utilizes an alternative splice donor site that truncates exon 1. This shortest isoform (3) contains no cadherin domains and lacks a signal sequence and transmembrane region. The functional significance of this isoform is unknown but the transcript is well represented in the EST database.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.